Microarray Probes on PGSC0003DMT400017167

Probe IDChipProbe Sequence
CUST_52073_PI426222305 JHI_St_60k_v1 ATGGTTTGAGTGCCAGAGTTCAAATGCTACGTTGTAAGATTGAATCCCTCGTCGTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017167

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017167 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G22160.1 +2 3e-31 115 64/127 (50%) Protein of unknown function (DUF581) | chr1:7823238-7823774 FORWARD LENGTH=147

Transcript Sequence (868 bp)

>PGSC0003DMT400017167 868 pgsc_dm_v3.4
TGACACTACTTCCTTCCCAAACAAAGCATCCTTCATAAATGCTTGACGTGGAAGCAGAAT
CAAACTAATTTTTTATCCATTAAAATAAAAACAGAGGATCAAACGGTTCAGATTCACTTT
ATATTTTTCCCCAATTCCAATTTCTTCTTCACTCCACTCTCCATACACGATGTTGGGGAA
AAGGGGCCGTCCACCGATGAGGAGGACAACAAGCATGACAGGGATCACCGTTGATCTTGG
TACTGCAACTGAATCGGAGCCGTCTGATTGTAATAAGCCTAAAATTATGGTTGATGAGAT
TAAGAGTTCGTCGGAGAAGGAAGGATTAATCATTAGTTCTGTGCCGGCGATGGTGTCGCC
AAGATACCAACGGAGAATCTCCGGCGAAGGTTTTGAGAGAGAAAGGGCTAATTTCCTGAG
AATTTGTGGCCTTTGTAACCGCCGATTGATTAATGGGCGAGATATCTACATGTACAGGGG
TGATACAGCATTTTGTAGTATGGAGTGTAGAGAAGAACAAATGAAGCAAGATGAAAGAAA
TGACAAGTCTAATATCAAGCCAGAAAATCATCACAATCACTCTGAATTTCGTTCTGCTAA
ATCTGAAGCTTCCAGCAATAACGACACCATTGCAGCAGCTTGAAGAACACACACAAAATG
AAAGAGAATAGGCATGCACAGTAGTGATGTGAGTTTTACTGGGTTGGGGACATTCGTGTA
AAATTTTAAGTATGTATTGTTATTTTACACAAACTTACACTAGGTGCCATGGTTTGAGTG
CCAGAGTTCAAATGCTACGTTGTAAGATTGAATCCCTCGTCGTTTTTTTTTTTTTTACTT
CGTTTCTTTTTATCTATTTATCTCTCTT