Microarray Probes on PGSC0003DMT400017048

Probe IDChipProbe Sequence
CUST_51229_PI426222305 JHI_St_60k_v1 TTTTTTGATGGACTCATGCCTCACAAAAGAAGAAGGCCGAAGAAGAGAGCTCAGAGACGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017048

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017048 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G11080.1 +1 1e-114 375 332/888 (37%) receptor like protein 35 | chr3:3470481-3473312 FORWARD LENGTH=943

Transcript Sequence (2634 bp)

>PGSC0003DMT400017048 2634 pgsc_dm_v3.4
ATGTCCAAAGAGTACTTTAGTTATTGGTCTGATGGAGATTCTTTCCCGAAAACAAAGTCT
TGGAATGAGAGTAGGGATTGCTGCAGTTGGGATGGAGTCACTTGTGACTTATTAAACGGT
CATGTTATCGGGTTAGACCTTAGTAGTAGTCTGCTTTGTGGAAGTATTCATCCCAATAGC
AGCCTCTTCCAACTTCATCATCTCCAAACACTAAACCTTTATAACAACCTCTTCAATTAT
TCTTCAATCCCACATAGCATTGGCCAATTGACGAATTTGAGGCATCTCAACCTTTCTCAT
TCTCACTTTGGTGGGAAAATCCCAACAGAAAACTCATACCTTTCTAATTTGGTTTTACTT
GATCTTTCTGTGTATGGATTACAACTTGATGAGAGAACATTTGAAACAATGCTTCACAAC
TTCACAAATCTGGAGGTACTAGCTCTCTCTCTTGGCGACATCTCATCACTGATACCTGTA
AGTATTCATCCCAATAGCAGCCTCTTCCAGCTTCATCATCTCCACACACTTAACCTTGAT
AACAATTACTTTTATCCTTCTTCGATCCCAAATGGCATTGGCCGATTGAGGAATTTGAGG
CATCTAAAACTCTCTGGCTTTGATGGGAAAATCCCAACAGAAATCTCATACCTTTCCAAT
TTGGTTTCACTTGATCTTTCTTATAGTTATAAATTCTTACAACTTGATGAGATAACATTT
GAAGCAATGCTTCACAACTTCACAAATCTGGAGATACTTTCTCTCTGGTATGTCAACATC
TCATCTCCGATACCTGTGAATATTTCTTCTTCCTTAAGATATGTGGATCTTGCACATACT
AATCTGCGAGGTGTTCTCACAGAGAGCTTTTTCCTTGTGCCAAACTTGGAAAGCCTCAAA
TTGAGTGGGAATGATCTTCTCAAAGGAGTTTTTCCAAAGATCCACCGGAGCAACACTCTG
TTAATGGAGTTGGATATTTCATCCACAGGCATCTCCGGTGAGCTGCCTGATTCAATTGGC
ACCTTTAGATTGACGAATAATTCCCTATCTGGCCCACTGCCTAGCAACCAAAGCATGCTT
CAAAAGCTAACCGAACTGAATTTGTCATACAACTCACTGAATGGTACCATACCTTCTTGG
GTGTTTAGCCTACCTTTGCTATCTTCAGTATCGCTCCAACATAACCGATTCAGAGGACTA
GCCGATGAAGTGATCAAAACAAACCCAACATTAAAAGAACTGCATTTAAGCAATAATCAC
CTCAGTGGTTCTTTTCCTCAATCACTTGTGAATCTCACAAACCTTGAAACCCTTGGAATT
TCATCAAATAACATCACCATTGATGAGGGCCACCTACCACAATTTCGTTACTATAACCTA
CAATATCTTGATCTGAAATTTAACTTCCTTCAGGGGTCACTACCTTTATCCATTTGTAAC
ATGAGGAAACTTATCTTATTAGATTTATCACACAACTACTTCAGTGACTCAGTTCCACAT
TGCTTGGGAATCATGGCTTCACTAACGGTGCTGAACTTAAGAAAGAACAACTTCACAGGT
AGTCTTCCTCCATTATGTGCACAGAGCACTTCATTGAGTACCATTGTCGTAAATGGCAAT
CGATTTGAAGGACCTGTTCCTGTGTCGTTGCTCAAGTGTGATAGACTAGAAGTCCTTGAT
GTGGGGAACAATGTTATAAATGACACATTTCCAGCTTGGCTCGGAACTCTTCAAGAGCTG
CAGGTCCTTATATTAAAGTCGAACAAGTTCCATGGACCTATAAGTACGTGTCAGACTAAG
TTTTGCTTTCCCAAGTTGCGAATTTTTGATCTTTCTCATAATGATTTTAGTGGCTCACTT
CCTGCAAAAGTTTTTGGAAACTTCAAGGCAATGATCAAATTAGATGGCGAAGATACAGGA
AATATCAAGTACATGGAATCTATGTCGAATTTGCCATTTGTCAGATCGTATGAAGATTCA
GTGAGTTTGGTAATCAAAGGGCAGGATATTGAGCTAGAAAGAATCAGCACAATTACGACA
ACCATCGATCTCTCAAACAACCATTTTGAAGGTGTCATTCCGAAAACACTAAAGGATCTC
AGCTCACTTTGGCTACTCAATTTATCCCATAACAATCTCATAGGTCATATACCAATGGAA
TTGGGGCAATTGAATACGCTTGAAGCTTTAGATCTCTCTTGGAATCGGCTCACTGGAAAG
ATTCCGCAGGAATTGACAAGGATGAACTTTCTGGCAGTTTTTAACCTCTCTCAAAATCAT
CTCATCGGACCAATTCCTCACGGTCTACAATTCAACACATTTGAAAATGACTCTTATGGC
GGCAACCTTGATTTATGTGGTCCTCCTTTATCAAAACAATGTGGAACGAGTGATTCATCA
CATGTTCCTCAACCATTGGAGTCTGAAGAAGATGAAGGTGAGACATATTTTTTTAGTGGA
TTTACGTGGGAATCAATAGTCATAGGCTATAGTTTTGGACTAGTTGTTGGAACTGTCATG
TGGAGTCTCATGTTTAAATATCGTAAGCCAAAATGGTTTGTGGAATTTTTTGATGGACTC
ATGCCTCACAAAAGAAGAAGGCCGAAGAAGAGAGCTCAGAGACGACGGACATAA