Microarray Probes on PGSC0003DMT400016959

Probe IDChipProbe Sequence
CUST_1712_PI426222305 JHI_St_60k_v1 ATTCACCCCTTCCAGAGCCATTCACTCCATTGAAGATTAAGAGGAGAAAAATTGAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016959

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016959 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g014370.1 +3 7e-07 37 19/30 (63%) evidence_code:10F0H0E0IEG genomic_reference:SL2.50ch02 gene_region:7190824-7191120 transcript_region:SL2.50ch02:7190824..7191120- functional_description:Unknown Protein (AHRD V1)
TAIR PP10None-----

Transcript Sequence (617 bp)

>PGSC0003DMT400016959 617 pgsc_dm_v3.4
TGAAATTTTTTTTAATTGTTTGCTACTATTTTGCTTTCTTCCAACAGATGATTCATCTAT
TGCAACAGATGGGTCATTTGTTGGTAATACAATATATACATAAATATTACAATAAGTATT
TTATCTATTATAATTTATGAATTAGTTTAAATATAAATTACTTTTGTATATAAATTGTGC
ATCCCTAACTTGTTCCCGTAGTAGCAATAGTTGCAAATGCCATTCTTTTTAACTCTAGGA
ATCATGGACACAAATCAGACCCTACGATGGATTTGATAAAAAGAGAATTGCTTGGAACAA
TAGGCATCAAAAGAGAGACACCTACTGGTGGTGCTGATGATGTTGCAACAGATGTTGATG
TTAATGTTAATATTCTGTTGATATTGGTGATACTGGTGATAAAAGTGGTGGTGAACATGT
TGATGATGTTGGTGGTATATATGGTGGATTCACCCCTTCCAGAGCCATTCACTCCATTGA
AGATTAAGAGGAGAAAAATTGAAAAAAAGGCTATTTTATATTTGATAGATTTTTAGTTAT
TTTATCATAAATTCTATTTTGTAAGTTGAAGAATTTGAAATGAATTGTAATTCATGAACA
TTTATCATATTTTGTTA