Microarray Probes on PGSC0003DMT400016881

Probe IDChipProbe Sequence
CUST_51291_PI426222305 JHI_St_60k_v1 TGGATTTTAATTGATCTAATTCATACCCATGGGAACTTTACCGCACATTTATTGGTTCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016881

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016881 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G28550.3 +1 9e-74 242 138/254 (54%) related to AP2.7 | chr2:12226168-12228251 REVERSE LENGTH=464

Transcript Sequence (1348 bp)

>PGSC0003DMT400016881 1348 pgsc_dm_v3.4
AAACAAGTATATTTGGGTATGGATATAGCTATTTTAACTATACAGTTTGCTTAATTTCGT
TGTTTCTGTGGATTTTGGTGCTAAAGCTGTGTCTATACTTTTTGCTAATTTTTGATTGGT
TTTTGTTGCTGCTTTATATTAGGTGGTTTTGATACTGCTCACACAGCAGCAAGAGCTTAT
GACAGAGCTGCAATTAAGTTCAGGGGTGTTGATGCTGATATCAACTTTAGCTTAAGTGAT
TACGAGGAGGATATGCAACAGATGAAAAACCTTGGTAAAGAAGAATTTGTGCACTTGCTG
CGACGCCATAGCACTGGTTTCTCAAGAGGGAGCTCCAAATTCAGAGGAGTGACGCTACAT
AAATGTGGTAGATGGGAGGCTCGGATGGGACAGTTCCTCGGGAAAAAGTATATATATCTT
GGGCTATTCGACAGCGAAGTAGAAGCTGCAAGGGCTTACGATAAAGCGGCAATTAAAACT
AGCGGAAGGGAGGCTGTTACCAACTTTGAGCCAAGTACCTATGAAGGGGAAACAATGTCT
TTACCACAGAGTGAAGGTAGCCAACATGATCTTGATCTGAACTTGAGGATATCAACCACT
TCTTCAAAGGAAAATGATAGGTTGGGAGGTTCTCGCTATCATCCTTATGATATGCAAGAC
GCAACCAAACCTAAGATGGATAAACCTGGTTCAGTAATAGTTGGAAGTTCACATCTCAAG
GGACTACCAATGATGTCCCAACAAGCTCAATTGTGGACTGGAATCTATTCTAATTTCTCT
TCCAGCTTTGAGGGAAGAGCATATGACAAGAGAAAGGATACAGTTTCATCACAAGGACCT
CCAAATTGGGCATTGCAAATGCCCAGTCAGGTTGATACGACCAACCCATTGACAATGTTC
TGCACGGCAGCATCATCAGGATTCTTCATTCCATCTACTACTTCTATCACTTCATCAGCA
TCTGCATTAGCAACTTCAACAAATGCCTCACAGTGCTTTTATCAGATCAACCCCCGCCTA
CCACCTCCATAACATGTTTTCTTCCATAACTAGTAATATAGGTATAAACATAGTCATTGA
TTTCTTTTGTAAGAAATAAATGACATTTTTGTGGATTGGATAATTTTTAGAACTGCTTCT
GAATCTGATGGGCAAAGATTCAAACTCCCATTGCAGATTGACTATAGTATTTGTGCTATC
CTTGCTTATCGTACTGCTACATTGGTGCAAAATGGCATTCTTCCGTCTCCTTTAATAATT
GAATATTGTGGGGAATCTAAAGTCCTGTTGGATTTTAATTGATCTAATTCATACCCATGG
GAACTTTACCGCACATTTATTGGTTCTG