Microarray Probes on PGSC0003DMT400016231

Probe IDChipProbe Sequence
CUST_16340_PI426222305 JHI_St_60k_v1 TTTGCTAAGGGCATGTTTAGAGACGACAACAATCCGGTACGCACTGTACAATTATATGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016231

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016231 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10None-----

Transcript Sequence (540 bp)

>PGSC0003DMT400016231 540 pgsc_dm_v3.4
ATGAGAACGATTTTGTCTTTAATACCGAAGAACCAAACAGGATTATTCTTCAGTATTTTG
GAGTCGAAAAAGCCATCAAAGTGTCAGTTGGTTGAAAAGTTTGATAATAAGGTTTGGGGG
GATAATGAAGATGATGCAGTGAAGTTTGCTATATTGTTCTATATATATTCATTCATCATT
TCCGAAGAACCAACCACTATTGTTATTGATAGGAAAGACTTTGATTTGGTTGAATCGGGC
AGATACATTGACTACCCATGGGGTAAAAAGGCTTTTGACCTTCTGATTCTGCATTTGCAC
ACTAAGATCAAACACGATGGGAAGTATTTCAGGTTGTTTGGTTTCCCACTTGCTTTGCAA
GTGTGGTTTTATGAATGTTGTTCGAATTTTGATGAGGAAATTACTGTTAAGGTATGTGAT
CACATCCCTAGGATACTTAACTGGAAGACAAAAAAAGATTTCCCTCGTCTAAGCTATTTT
GCTAAGGGCATGTTTAGAGACGACAACAATCCGGTACGCACTGTACAATTATATGTATAA