Microarray Probes on PGSC0003DMT400016056

Probe IDChipProbe Sequence
CUST_33038_PI426222305 JHI_St_60k_v1 ACGGTTGATCAACTTTGGAGTGATTACAAGGCTAAATTTGGGGCATAACTTAAGAAATCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400016056

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400016056 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G15220.1 +2 5e-104 306 143/224 (64%) Plant basic secretory protein (BSP) family protein | chr2:6608689-6609366 FORWARD LENGTH=225

Transcript Sequence (840 bp)

>PGSC0003DMT400016056 840 pgsc_dm_v3.4
TAGCAAACAAGCAATGGCTAATAACATTTTCTTCATTTCTTCTTTATTTGTCTTGGCAAT
ATTCACCCAAAAAATCGATGCGGTAGATTACTCTGTCACCAACACGGCTGCAAACACCCC
TGGTGGTGCCCGTTTCGACCGAGATATTGGAGCTCAATATAGTCAGCAAACACTCGTAGC
TGCCACTTCCTTCATATGGAACATCTTCCAACAGAATTCTCCGGCTGACCGCAAAAATGT
TCCAAAAGTAAGCATGTTTGTCGATGACATGGACGGAGTAGCTTACGCTAGCAACAATGA
GATTCATGTTAGTGCAAGGTACATCCAAGGTTACTCTGGAGATGTTAGGAGAGAGATCAC
CGGAGTATTATACCACGAAGCCACTCACGTATGGCAGTGGAATGGGAACGGTGGGGCTCC
CGGAGGATTAATTGAAGGAATTGCTGATTATGTGAGGCTCAAAGCTGGTCTTGGGCCAAG
CCACTGGGTGAAACCAGGCCAGGGCAATCGTTGGGACCAAGGCTACGACGTGACTGCTCA
ATTTCTTGATTACTGCAATAGCTTGAGAAATGGATTTGTGGCAGAGCTTAACAAGAAAAT
GAGAAATGGCTATAGTAATCAGTTCTTTGTTGACTTACTAGGGAAGACGGTTGATCAACT
TTGGAGTGATTACAAGGCTAAATTTGGGGCATAACTTAAGAAATCCAAATTAAATCGAAA
ATGAGAAACATCATCTATTGCCTTTGTACCAATATTACAAGTATTTGTGTTATGGTCTTG
TACTCTTGTTGAAGATATTGTAGTAACAATAATAATAATATTAATAAAAATAAACACAAG