Microarray Probes on PGSC0003DMT400015950

Probe IDChipProbe Sequence
CUST_27883_PI426222305 JHI_St_60k_v1 TAGATTAGTATCAGTTCAGCTCACCGTTGACCTCAAACCTAACTTACCTCGGGAAAGCGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015950

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015950 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G05640.1 +2 1e-137 422 208/355 (59%) Protein phosphatase 2C family protein | chr3:1640610-1642227 REVERSE LENGTH=358

Transcript Sequence (3094 bp)

>PGSC0003DMT400015950 3094 pgsc_dm_v3.4
AAAAGAATGACATGACTTTTAATTTTTCAAAGTTTACCCTTAGAAATGTCATTTTCAAAC
AGAAGGGAGGGAATGGTAATTTGTTCCTCCTCTTGACTTGTATCCTTAGAGATAATACGA
AGTTTATAGATTATGTTTTTGGTTGGAAATCAATCTAAAAAGAATGACATGACTTTTAAT
TTTTCAAAGTTTACCCTTAGAAATGTCATTTTCAAACAGAAGGGAGGGAATGGTAATTTG
TTCCTCCTCTTGACTTGTATCCTTAGAGATAATACGAAGTTTATAGATTATGTTTTTGGT
TGGAAATCAATCTAAAAAGAATGACATGACTTTTAATTTTTCAAAGTTTACCCTTAGAAA
TGTCATTTTCAAACAGAAGGGAGGGAATGGTAATTTGTTCCTCCTCTTGACTTGTATCCT
TAGAGATAATACGAAGTTTATAGATTATGTTTTTGGTTGGAAATCAATCTAAAAAGAATG
ACATGACTTTTAATTTTTCAAAGTTTACCCTTAGAAATGTCATTTTCAAACAGAAGGGAG
GGAATGGTAATTTGTTCCTCCTCTTGACTTGTATCCTTAGAGATAATACGAAGTTTATAG
ATTATGTTTTTGGTTGGAAATCAATCTAAAAAGAATGACATGACTTTTAATTTTTCAAAG
TTTACCCTTAGAAATGTCATTTTCAAACAGAAGGGAGGGAATGGTAATTTGTTCCTCCTC
TTGACTTGTATCCTTAGAGATAATACGAAGTTTATAGATTATGTTTTTGGTTGAGATTTA
TTTAAATATTCGATATGGATCTGATGGAATGGAATTCTAGCTTCTCCTTTTACCGAAGAA
TGCTTGACTAGGGTAATAGTAGTCTTTATCTGCCTCTTTGGATCCAAAATATTGCAAGTA
TATATGGTGAGAAATTAAAGACAACTATTATATAGTTGCCACTAATATATATGTATTTCT
TCTCTTGAAGCAGTCATGATATTTGGACCTTTTCAATTTCTTATGACTGAGAAATCCGTT
TGGAGCCAAGTGCCAACCCTCAGGATCAAGCACTGCTAGCCTTCTAAAGCCGCTAGCTCC
TATCCCGTTCCACTTAAATACCAAGCTTAATTCGCATGGTGGGGTCAGGGACTAAACCTA
AGCTTAAATTTGCCCCTTGATCAAACAAACTCAAATCCTGATTAATGGTTGACTATTAGC
TTTAGTAAGCTTTCCTGCTGTGAAGTTACTAACTCAAAGAAAATATTAGCCTTGACAATG
AATCTTGTTTTGGATGAGTTGCACTATTGGTGATTACATCTTTTTTTTGTTTTGATCAGT
AGAGAAAACCTTTCATTTCTGGAATACAGCTTCAAACTGCTTACAACAAAGGGCCGTTTT
CAATTTAATTTTTCCTTTGAGGAGGTGGGGGATCAAGCTATTGTCTCTTGCAGAAATGCA
AGGTTAGGCTGCTTACAATAGACCTTTGTGTTCCGGCCCTTACCTGAACCCCACACATAG
TTAGTGCACTGGCCTTTATCATCACTTGGAGGCTTAATAAGTTGATCAAAAGAAACATAT
GGACAAAAAGTTGTTTTGACTTTTAATTGGTGGGTTATAAATTAATGTTCTGTAGCATGC
ATGTTGATTTATATGTTGGAATATCATGACCATTTCAGTTTTTTTTGGTTGTTTTCATAT
ATTGTAGCTAGTCACAAGGAGTACTCCTAATTCTACATAATTGTACTTGGGTATAATTAG
GAACTAAAAGATGGTGCAGTTCTCTTCTATTTTCACTGGCTTTACGAAATCTATAGCAAT
CAGAAATGGGAAGAAAAGTAAACATGATGACGGAAGGGAAACTGCAGATTCACTGGCTAA
AGAAGCTAAAAAGAATGAGATGATGTTAACGTCATCTGGCTCTGTAGCTGGCAATTTGGC
TGTTGTTTTCTCCAAAGGAGGGAAGAAAGGTATCAATCAGGATAGATTTGTTGTGTGGGA
GGATTTTGGATGCCAAGATGACATGATCTTCTGTGGGGTGTTTGATGGGCATGGTCCTTG
GGGTCATCTTGTTGCTAAAAGAGTCAGAAAACTGATGCCACCAGCTTTGCTTCGTAATTG
GCAGAAACGAGTTTCACACACCGTGGATGGTACTGATGGGATATCGATAGATAGAAGTTG
TTTCCAGTTTGACATTTGGAAGCACTCCTACTTTGAGACTTGCTCCATCATCGATCAAGA
GCTCGAACAGTATGCTGACTCTTTCTACAGTGGTACCACAGCTTTAACGCTCGTTAGACA
GGGTGATCTACTGGTAGTAGCAAACGTTGGAGATTCTCGAGCTGTATTAGCAACAACAGA
TGATGATGGTAGATTAGTATCAGTTCAGCTCACCGTTGACCTCAAACCTAACTTACCTCG
GGAAAGCGAGCGAATAATGCAGTCAAGAGGGAGAGTGTTGTCATGTGAAGATGAACCAGG
GGTGTATAGAATGTGGATGCCTACAGTCGAAGGGCCTGGATTAGCAATATCAAGAGCCTT
TGGTGATTACTACATAAAGGACTTTGGCCTTATTTCAGAACCAGAATTGACATCCAGAAA
CATAACACATAGAGATCAGTTTGCCATCTTGGCAACAGATGGGGTTTGGGATGTGATGTC
AAATGAAGAAGCAGTGGAGATAGTATTTTCAACTGAAGAAAGGGAAGATGCAGCTAAGAG
GCTGGTGGAAAGTGCTATTTGTGCGTGGAAACGCAAACGAAGGGGCGTTCCCATGGATGA
TATCTCAGCAATATGCCTCTTCTTTCATAACATTCCTCCTTCAAAACAACAAGCTAAGAA
TGTCTAAAATTCAACAACAAGCTTACATGAACTACTAGCTGACTTTCAATTGCTGCTTTT
TCCTCTTCTTAATATTTTTTTCAGTACTTGATGGTTTGTACATAAGTTCATACATACATA
TATAGGCTCTTCATGTTTGCTATTATATTTCAATCAGGCATTGAAATGAAATATATTGAA
AATCAAATCAGCTTCAAAGTTGAGGAATATGCTTAATATCTGTTTTCCAGAGATATTGTC
AATATTATGGTGCAAACTTTAAAATGCAAAAAAG