Microarray Probes on PGSC0003DMT400015350

Probe IDChipProbe Sequence
CUST_38840_PI426222305 JHI_St_60k_v1 GTAGATCGGCTTACCGAATCATGTTAAATGTATGTGTTTGTTGTTGCATGACAATGAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015350

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015350 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G71050.1 +3 3e-63 200 100/153 (65%) Heavy metal transport/detoxification superfamily protein | chr1:26803322-26803946 REVERSE LENGTH=152

Transcript Sequence (919 bp)

>PGSC0003DMT400015350 919 pgsc_dm_v3.4
TATTAATTAACCTATCTTTCTTCCCTCTATATAATAATATTTTTGTAAGAAAAAATAAAA
TGGGTATTATTGATCACATATCAGATATGTTTGAGATTACAAGTACTAGGAAGAGCAAAC
GTAAACCAATGCAGACAGTTGAAATTAAGGTGAAAATGGATTGTGATGGATGTGAAAGGA
AGGTTACTAATGCAGTTTCATCTATTAAAGGTGTGAAATCAGTGGATGTAAGTAGAAAGC
AAAGCAAAGTAACAGTAAGTGGTTATATTGAACCAAAAAAGGTGTTAAAAAGGGTGCAAA
ATACAGGAAAAAAGGCAGAATTTTGGCCATATGTTGAATATAATTTGGTGTCATATCCAT
ATGCAATAGGTGCATATGACAAAAAGGCACCCTCTGGCTATGTAAGGGATGTTCCACAAG
CTTTTCAAACACCAAATACCCCTACTCAAAGGCTCACCTCGATGTTTAGTGATGAAAATC
CTAATGCTTGTCAAATCATGTGACCATATATTTAAGTGCGTGATTCGGATTTCAGAAGTT
TCAGATTTAAGTGCGTGATTCGGATTTAGTCAAAACTTCAATGCGGACTCCAAACTTCAG
GTGGGAAAATATATATATATATGTGCGCACTAAAATTTGTATTTTGAAATATAGTGGGAG
TACTAAAATTTTGGTCTTAGGCTAGTTATAAAGCAAAAAAGTTTGTGCTAGTTAGATGTT
TGTTGTGTCTCACAAATTTTTTCCTTAGATAGAACTTTAACGCCCCCTATATTGTGAATT
GCTCTTCTTCTCTTGTGGATGTAGATCGGCTTACCGAATCATGTTAAATGTATGTGTTTG
TTGTTGCATGACAATGAATTTAACAATATAATTTAATCAAATTTAAGTGCCAAACAAAAC
AAGTTGTTAGTTATCGGAG