Microarray Probes on PGSC0003DMT400015253

Probe IDChipProbe Sequence
CUST_40055_PI426222305 JHI_St_60k_v1 GCCAGTTGTTTGGTATAAAGTTACTATTATGCTTGTGTGAAATAAAGCCAGTTGTTTGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015253

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015253 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G12490.2 +1 1e-24 99 49/92 (53%) cystatin B | chr3:3960523-3961876 REVERSE LENGTH=234

Transcript Sequence (770 bp)

>PGSC0003DMT400015253 770 pgsc_dm_v3.4
ATCTAATAACTCTTTCATTTGAATGAACGTCATATACAATCTATTTTTCAGAAGGCTCAT
TTGGAGTTTGTAGAAGTTTTGAATGTGAAGGAACAAGTTGTTGCGGGAATGATGTACTAT
ATAACACTTGCGGCAACTGATGCTGGAAAGAAGAAAATATATGAAGCTAAGATTTGGGTG
AAAGAATGGGAGGACTTCAAGAAAGTTGTAGAGTTCAAGCTTGTTGGTGATGATAGTGCA
AAGCTTGGGGGCATTATCATTGTTCCATTCCCAATCAGCTTTGAAATCCAAGATCTTGCT
CGTTTTGCTGTTCAAGATTATAATAAGAAAGAGAATGCTCATTTGGAGTTTGTAGAAGTT
TTGAATGTGAAAGAACAAGTTGTTGCTGGAATGATGTACTATATAACACTTGTTGCAACT
GATGATGGATATAAGAAAATATACAAGACCAAGATTTGGGTGAAGGAATGGGAGAATTTC
AAGGAAGTTCAGGAATTCAAGCAAATTGTTTATGCCACAAAATGAAATAAAACTACTCTT
ATGCTGGTGTGAAGTAAAGCCAGTTGTTTGGTATAAAGTTACTATTATGCTTGTGTGAAA
TAAAGCCAGTTGTTTGGCATGCAATTACTGTTATGTTTGTGAAAAATAAAGTCAGATCTA
TGTATCTGACAGTATTTAAATGTCTTGTTGTAAGTGTATTTGAATAATTTAAAGTTTGTA
AGATTAATAAATGTGTGTTTATGTGATGATAAATATTGATGGAGTTGTCA