Microarray Probes on PGSC0003DMT400015179

Probe IDChipProbe Sequence
CUST_40107_PI426222305 JHI_St_60k_v1 GGAGTAACTCTCCATGTGTACAAATTTATTTTGTGACAAGATATCCTGGTCAATAGAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015179

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015179 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G11840.1 +1 7e-93 292 171/455 (38%) plant U-box 24 | chr3:3736578-3738250 REVERSE LENGTH=470

Transcript Sequence (1342 bp)

>PGSC0003DMT400015179 1342 pgsc_dm_v3.4
GAAGAAGTAGAAATACCCAAATATTTTCTGTGTCCAATATCACTCCAAATTATGAAAGAT
CCAGTTACAACAGTTACTGGAATTACATATGATAGGGAAAATATTGAAACATGGTTGTTG
ATGGCGGAGGAAAATGCATATACGTGTCCCGTGACAAAGCAAATTTTGTCTAGAGACACT
GCATTGTTAACACCAAACCATATGTTAGGGAAATTTATTCGATCGTGGACTATATGCAAT
GCTGAGAAAGGGATTGAGCAAATTCCATCGCCTAAATATCCTCTCAACAAATCACATGTC
ATCAGGCTAATTCGTCAGGTGAAAAATCACGATCTTTATTTAGAAGCTTTAAGGAAAATG
GTGACTATGATAAGTGAGAATGAGGAAAATAGGAAGTGTTTAGATGAAGGTGGTGCAATT
AAGGCTATGGTTTTATTTATATTGAGGAGTTTTAAGGAAGGGGAATTAATTATGGGAATT
GAAGAAGCTTTAAGGATTTTCCATCTTGTTTGGAGACCAACACATGAAAACAAACAACTT
GTTAAGGAAAATCATGATCTAATTGAAGCTATTTTATGGATTTTGAAGAGTCGTGAAATG
TGCAACAACAACAATAATCAAGTTGTAACATCAATCAAGACTCATGCAATGCTGGTCCTG
AAAAATGTGATCTCAGTTTCAAGTACAAATCTTTTATCGAGTCTAACACCTGAATTTTTC
CAACAAATGTTGAATAGTTTGAGGAAAAACAATGTAAAATATGTGTCTCAACAAGCAACA
AAAGCAGTGTTACATGTGCTAATAGATACTTGTCCAAGGGGACGAAACAGGCTGAAAATG
ATCGAATTAGGGGCTGTTTTCGAGCTAATTGAGCTTGAATTAAGCAACAATGAGAAGAGG
GTAAGTGAATTAGTTTTTTCACTTTTGTCACATTTGTGTAGTTTAGCTGATGGAAGAGCA
GAATTACTAAAACATGCAGCTGGAATTGCAATTGTTTCTAAAAAGATACTTAGGATTTCT
CCAGCAACAGATGAAAGTGCAATTCAAATTCTTGGATTAATTGCTAAGTTTTCAGCTACA
AAAGAAGTGTTGATGGAAATGTTAAGAGTTGGGGGAGTGACAAAGTTATGCATGGTGATT
CAAGCAAATTGTGAAGCAAGTTTAAGGAAAAAAGCACTGGAAATATTAAGGGCACATAAT
AATGTTTGGAGTAACTCTCCATGTGTACAAATTTATTTTGTGACAAGATATCCTGGTCAA
TAGAGATTTACAATCTCTTTATTTCAATATTTTTTGGTATGATATACTTGTAGAAATTGT
AGCAACATTATATGCTTTTCTT