Microarray Probes on PGSC0003DMT400015084

Probe IDChipProbe Sequence
CUST_40104_PI426222305 JHI_St_60k_v1 CTGTCATTTTTGTGATTTTGCTTAGCTTACAGCGTTGAACTGACTATCGTCTCAATTGGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015084

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400015084 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G27230.1 +1 1e-63 217 115/181 (64%) transcription factor-related | chr2:11650895-11653840 FORWARD LENGTH=650

Transcript Sequence (1150 bp)

>PGSC0003DMT400015084 1150 pgsc_dm_v3.4
ATCTGATTTCAGTGTAGCATTGATGCACTGTTCGAACGCACGATCAAACACATGCTTTTC
TTGCAAAGTGTCACAAAACATGCAGACAAACTAAAACAAACTGGAGAGTCAAAGATCATC
AGTAAGGAAGGAGGATTGCTTTTAAAGGATAATCTTGAAGGTGGAGCAACATGGGCATAT
GAAGTAGGCTCACAGTCTATGGTCTGCCCTATTATAGTTGAGGATCTAAATCAACCGCGT
CAAATGCTTGTGGAGATGCTTTGCGAGGAACGGGGCTTATTTTTGGAAATAGCTGACATT
ATAAGAGGATTGGGCTTGACTATCCTGAAGGGGGTGATGGAAACAAGGAACGACAAAATA
TGGGCACAATTTGCTGTAGAGGCAAACAGAGATGTCACAAGGATGGAGATATTCATCTCA
CTCGTTCGCCTCTTGGAGCAAACAGCAAAAGGTGGAACAGAACCTGTCAATGCTGCTGAT
AACAACACAGCAATGGTGCATTCATTCCACCAAGCAGCGACATTACCTGCAACTGGTAGA
TCATGTAGTTTGCTGTGATCAACACGTTACTACTGCTTCACCTGGTAATGTTAAGAGCAA
GCGACAATTACATGCTTGCCATGACTAACATTTACACCAAAATGATACTTCTGGTGGTTC
TAACGCTACTCCGTAATTTTTGTGCCCCATGAGCCAAGCTGTGTCAGAAATTCAGAATCC
ACTGAAGAGCATAAGCTCTACTTTAGGCCCTCATTCAAGGTGGATAGAATATTCCAATCC
ATCCCTGGTTGTAAACTTGTAAAATATGTAGCAATGCTATAGAATACCTTCCTGTAGGAT
GCTATGATTGCACAAGTTAGTTGTTTTGATTCTTTCCTTAAATGTGCTTGTTTTATGGGG
TTGGTCATAAAAGGGTTGTTTGTTAGTTTAATGTATAGGAAAGTTTGAGATGATATAAGG
GGTGCTGGGAGATTTTATTAGCTGATGTCTTCCTTTATTGCAATTTTTGTGTTTTTGGAC
TTCCAATTCTGTTTATGCTACCCAAATGACTCTTGTAATTTGTAAAGCTGTCCTTTGCCC
TGTACTATTTCTGTCATTTTTGTGATTTTGCTTAGCTTACAGCGTTGAACTGACTATCGT
CTCAATTGGT