Microarray Probes on PGSC0003DMT400014695

Probe IDChipProbe Sequence
CUST_6707_PI426222305 JHI_St_60k_v1 TGTTGTTTCTGAGCAAATCAAAACTCGCCTTGAAGTGTCTCAACAAGAAACAAATACAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014695

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014695 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18170.1 +3 3e-81 260 144/210 (69%) FKBP-like peptidyl-prolyl cis-trans isomerase family protein | chr1:6254291-6255507 FORWARD LENGTH=247

Transcript Sequence (1968 bp)

>PGSC0003DMT400014695 1968 pgsc_dm_v3.4
CGTTAGTGTTGACAAAATATAGTACCTGCTTGCGTGTCGATACAAGGTTATCTCTGGTTT
TCTTGATGTAAAAATCTGATTTTTTTGCTTTTCCTGTTTAATGTGTAGAGATCCAAAGTT
ACGACCTTCATTTGCTGAGATTATGGCTGCTTTGAAACCACTGCAAAAGCCTATAACCAG
TTCACAAGCACCAAAACCACTGGGGAACAGAGGTCAAGAAAAGGGTCGGTCATAAAGAAA
CGTGGATGATCCAGCAGCATAGTATGTTTAGGACAGAAGGGAAAACGGAATTTTATCTTT
TGTTGGAAATGAAGACAGGTCCATATTTGTTTAACCAGAAATTAAAGGAAGACATAAAGG
ATCTGTCAACAAACATATACTTCATGATGAGTCAATTGTTGTGATTTTTTTTTTGTTTTT
TTTGTTTTCTGGCAGTTGTCAACCCACAGGTCCTCAACATTGTGCATCTTATCTTATGTA
TAATTCATTTTTGGGATCATTTTGTAATTAACAGAGATTGAGAACATTTCCCATACTTCC
ACATCAAATACTTTGAGATGCTTGATTATCCAGTTGCAGCAGTAGAGGAACAGCCTCATC
CTTTTTTGTTTTTTGAATTTAAAGATTTATGTAATAGTCAATTGTTGATTTAGTTTTTAG
TTGAAATAGCATGCCTGGAGAAAACTGATTCATGTAAAGATAAGGTAGGGACCATTTACT
ACAACTGTATACAGTTGAGTCACTACAAATATCTGCTACTCTCTCATATGCTCATTTCAT
ATCCAAAAAACATGGCCACTCTCTTTGGATCCACACCTTCTCTGTCTCACCCAATTACCA
GAACTAACTTTTCTTCATCCTCCCAAACTCCTCCTCCTTCTCAGCCACCAAATCAAAATC
CACAACCACAAACTTCACCGCCATCTCAGCCACTGAGTGCAACTTCTGCAGAGCCTCCAT
CACCTGTTAATGTGCAGCAGCAAAAGCCTAGTAAATCTGCCCGCCTATCAACCTCTGCGG
ATTCCACTGATTGGATTGCCTCCTCCTTAACTAGGAGATTTGGCCTTGGTGCTGGACTTG
CTTGGGCTGGTTTCCTTGCTTTTGGTGTTGTTTCTGAGCAAATCAAAACTCGCCTTGAAG
TGTCTCAACAAGAAACAAATACAAGGGTTGTTGAGAAAGAAGAAGAAGTGGTCTTGCCCA
ATGGGATAAGGTATTATGAACTGAAAATTGGTGGCGGTGCAACACCAAGGCCAGGGGACT
TAGTTGTGATAGATGTGAAGGGAAGCATACAAGGCAGTGGACAAGTTTTCGTGGATACAT
TTGGTGGTGATGGAAAGAAGAAGAGGCCATTGGCATTAGTAATGGGATCAAGGCCTTATA
GTAAAGGAATTTGTGAAGGTATAGAAACTGTTCTAAAAAGTATGAAGGCAGGTGGAAAAA
GAAGAATGATAATTCCTCCAAATTTGGGATTTGGAGAAGAAGGAGCAGATTTAGGAACAG
GGCTGCAAATTCCTCCATCTGCTACTCTTGAGTATGTCATTGAAGTTGAAAAAGTTTCTA
TTGCACCTGCTTGATTGAAGGTATACAAATTGGAATATCAAATGGTATAACTTCAAGTGT
TTGCTACTAAAAGGAAAATGCAAAATACTAGCTAATTATGTATTGTTCTTTAGTTGGCAA
GAAAGATGTGTGAAAGTTGATTGCAACATATTGAGGAGGGGCATTCTCTCTTTCTACATT
AAGAAGGAGATTAACCATTCTTGCAATTGGTGCTTTCATAATTTATTGATCTGATTAATT
TGAATTTTCCGATGTGCAAGACCACTGAGAAGTACGTTCCCTATCACATTCTCAAAGATC
TAGATATAATTTTTGACCAACTAAATACGATAGGTAGAATGAATTAGTATCCATTGGCCA
TAACTTGTGAACAATTGAGCAATAAATATATTTTTTACTTGTGATGAT