Microarray Probes on PGSC0003DMT400014682

Probe IDChipProbe Sequence
CUST_6379_PI426222305 JHI_St_60k_v1 AGAAACAGATTTTGCAGAGCCAACTTGCCTTTGTCGGGACCGGACTTATTCCTATTACTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014682

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014682 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18390.2 +2 2e-168 506 298/626 (48%) Protein kinase superfamily protein | chr1:6327463-6329935 FORWARD LENGTH=654

Transcript Sequence (2416 bp)

>PGSC0003DMT400014682 2416 pgsc_dm_v3.4
CAAGTTTGTCATCTTTTGTTAGTCAAAACTGGATTAACTTTGACACTTGAACAACTCAAT
TGAATCATATATTTTGCCAAACTCTTCTAATACATAGGTTCTCCAACCAACATAGTCTAT
CATTGATGAGTTCTCACAAATGCATGCTCAAAACTTCCCTCTTCCTCTGCTCCATTCCAT
CATCTCCTTCCTATGCTTCTTGATCACGTCCTCGCCATCCTATGGCCAAGAGGATAAACA
GTATTCCACTTGTAATAGCTCCTACACCTGTGGGAATATTCAAAATATCAGCTTCCCTTT
CTGGGGTGGCGATCGACCTCAAGAATGTGGTCTTCCACAATTCAAGCTTACATGTGAAGC
CAATCAGGATCCCCTTATACATATCGATGGTCATAATTTTCGCGTACTTGGCATCAATGG
AGACAATCAAACCATGAGAATTGCACGAAATGATCTTGAGGAAGACATTTGTCCTGATAG
ATTCGGTAACACTAGCTTTAATGATCCCCTATTACGCTATGGTCCTGACTTTGGGATTCT
CATCCTGTTCTATGCTTGTCCTTTTGATATACCTTCTGAATGGAAAAATTTCACCTTTAG
CTGCAATAACACTGGAGAGTCCAGTCATGGTTTCTATCCAGATCAGTCATTTATATCATT
CTGGGGACCGCAGTATGGGAGTTGTGAGCGTAATGTCATAGTTCCTGTGTTGTTAACGGC
ATTTAAGCGGTTCCAAGACCAAGGAAGTACGAAAATATTGGAGCTATTGAAGCAAGGGTT
TGATGTGGTTTACAACAAAAGCCTAGTATGCATGGCTTGTGAGAGATCAGGGGGGTTATG
TTGGTCAGAAACAGATTTTGCAGAGCCAACTTGCCTTTGTCGGGACCGGACTTATTCCTA
TTACTGCGGTTTTGTACAGGAACAAGGTGATAAAAGAGATATCAGAGTGAAGGTTGCCGT
AGGTGTAACTGCAGCTGCATTCACTGCCATTGTGGCATGTGTAATTTTCTTTCTCTATTA
TCGTCGACAGAAGAAAAGTCATGCTGGTTCGTCTTTGATAACCAGAAGTATCCTTTCCTA
TCCCTCCTCAACAATGGACCCTGAAAAATCTTCTCACTATTTGGGAGTTCATGTCTTCGA
CTACAATGAACTGGAAGAAGCCACAAACAGTTTTGATTCCAGCAAAGAGCTAGGAGAAGG
TGGATTTGGCACAGTATATAAAGGTAAACTTCGAGATGGGCGTGTTGTTGCTGTAAAGCG
TTTATATGAGAACAACTACAAGAGGGTTGAGCAATTCCGAAATGAAATTGAAATCCTCAC
TCGTTTGCGCCATCGAAATCTAGTTACCCTTTACGGATGCACATCTCGCCATGGCCGTGA
GCTTCTTCTTGTGTATGAATATATTTCCAATGGTACTGTTGCTGATCATCTTCATGGGGA
ATTCTCAAAGCCTGGATCGCTTTCATGGAATACACGAATGAGCATTTCCATAGAAACGGC
AAGCGCGCTAGCCTTTCTCCATAATTCAGAGGTCATTCACCGAGATGTAAAAACTAACAA
TATCCTCCTAGACAGTAATTTCTGCGTCAAAGTAGCTGATTTTGGATTGTCTCGGCTTTT
CCCTACTGATGTTACACATGTCTCAACAGCTCCACAGGGTACCCCTGGATATGTTGATCC
CCAGTATCACGAATGCTATCAACTCACCAGTAAAAGTGATGTTTATAGTTTCGGGGTGGT
ATTAATCGAGCTTATATCCTCTCTGCCAGCTGTTGATATCTGTAGGCATCGACAGGAAAT
AAATCTATCAAATATGGCAATTAACAAGATTCAGAGCAACGCATTACATGAGCTGGTTGA
TTCAAATCTTGGTTTTGACTCCAATGACTTGGTAAAGTTGATGATCACTGCCGTGGCAGA
GTTGGCTTTCCAGTGTCTTCAGAACGACAGGGATTTGAGACCATCCATGCCAGAGGTTTT
GGAAGCTCTACTGGGAATTCAGAGTATGGATAAAACAGCAACAGAAATAGGGAAGCCAAG
TCCCGGTGATGATGCTGGATTGTTGAAGAATCACACATTATCTCTCTCACCCGATTCAGT
TATTTCAAAATGGACTAGCAGTAGCAGTTCAACAACACATGCTTCCAGTATTGGCTAAGT
TTATGCCCTTAGTTTGTCTAGTTTGTGGTTTTCTTGATAGTGATTCTTCAGCCACCTGCT
CTATTGGTCGCGGAAGGTGAATTTTAGTGTCTTTCCTTTGAGTACTTTGGACCTTTTTCT
ATCTTAAAGAGGTTGTACATATCTCGTATGCAGCAATTTAAATTTATCAATACTAATTCA
ATTCATTTCTTAAATTCTTTAGTTAAATTGTGTAGATACTTGTTCAATTGATCATCTTTG
TCATAACAGATTTTGA