Microarray Probes on PGSC0003DMT400014656

Probe IDChipProbe Sequence
CUST_6534_PI426222305 JHI_St_60k_v1 GAAAGCAGTTCAGCTTATTCATCCCCTGCAGCTTCTGCTACGGGGAATAAAAGAAGAAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014656

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014656 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73830.1 +3 2e-60 197 128/255 (50%) BR enhanced expression 3 | chr1:27760027-27761346 FORWARD LENGTH=261

Transcript Sequence (1053 bp)

>PGSC0003DMT400014656 1053 pgsc_dm_v3.4
CAAAACTCTCTTATCACAAACAAAAAAACACACACAACATAAAGGACCAGTTCCTTCACA
CACACACAAAAATGGCTGATCATCAATTCAACTCAGACATACAAAATTTTATCACAAATT
CACCATTTTCTCTATTAAATTTCGATTCGAGCATCGATTTAATGAACCAATTTCCAGATA
TGATGAACATTCCTTGTTCATCAGACATGTCAAGTTTCAATATACAGAGTTCAATGGAAT
TTTCGAATGATAATGTTTTCACTCAAGTAGCTGATCAGTTTCCAGGAAGTTTACAAGAAA
TATTTCAAGGAAATATACAACAAGAAAGCAAAACAGAGGAAATTAATGATAGTAAAAAAA
GGAAAATTAGTGATACTCCTGAAAGCAGTTCAGCTTATTCATCCCCTGCAGCTTCTGCTA
CGGGGAATAAAAGAAGAAATACTAAAGGAAGAGGAAATAGAGTGAAAAGTGATGAAAAGG
AAGAAGAAAAACCAAGAGAAGTGGTTCATGTTAGAGCTAAGAGAGGCCAAGCAACTGATA
GTCACAGCTTAGCAGAAAGGGTTAGAAGAGGAAAAATTAATGAAAGACTTAGGTGCTTGC
AAGATATTGTTCCAGGATGCTACAAGACAATGGGCATGGCGGGAATGTTGGATGAAATTA
TTAATTACGTGCAATCCTTGCAAAATCAAGTTGACTTCCTCTCCATGAAACTTACCGCAG
CAAGCTCATACTACGATTTCAACTCGGAATCTGACATTCTCGTGTCATTGCAGAGAGCAA
AGGCATATGAAGCACTAAAAATGCAGAAAATGATGAAGAAGGAAATTGGATGTGAAGTGA
TGTCTTCAAATCAAGTTGGTCCTAATTTTGGAAGTTATCCAATGTTGCCATACAACACCT
GAAGATTCCCCCCAATTATTTTTTTATTTTCAATCAAACTTTTTTTCCACTTGGTGCTAT
ACATTTGTAATCTTTGTACACATTGGAAAAAAGAAATTAAGAAATTTATATATTAATATA
CTTGTATTAGGACTCACTCATCTTTTATGTGGG