Microarray Probes on PGSC0003DMT400014624

Probe IDChipProbe Sequence
CUST_6733_PI426222305 JHI_St_60k_v1 CAATTGCAGATGATAAGCGCAAGTGGGTTTACTCTACTCACGTCGTTTCCCCAAATCAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014624

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014624 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73875.1 +2 1e-112 243 120/208 (58%) DNAse I-like superfamily protein | chr1:27781112-27784571 FORWARD LENGTH=454

Transcript Sequence (1875 bp)

>PGSC0003DMT400014624 1875 pgsc_dm_v3.4
TATTTATGTCTTTTTAGTTTCACCCCTATTCGTCCTATAAAAGGTTAAACACGCGCCGCC
CAAATTCAAATCTCCCGGCAACATGGGCCGAACCGGCGACGGCAGAGATCCACCGGCGGA
ACAGCCTTCTCGGTTTTCAGCTTCAATGAAAAGTAGAATTAGTCAACATGATATTGGTAA
ACACCGTAGCAAGAAGAAGCAAAGAGTATCAATAAGTAAAACTGAAACGGAAACTGCAAC
CCTAACCCTAAATCATACTTCCACTTCTTATACACATTCATATGCAAATTCGTACTCATA
CTCGTACAGTAGGGGCAAAGAAAAACGGCATAAAGGAAAAGCAAAGAGGGCAATTGCAGA
TGATAAGCGCAAGTGGGTTTACTCTACTCACGTCGTTTCCCCAAATCAAGATAGAGTTGT
TTTTATGTCGTATAATATACTAGGGGTAAAAAATGCTGCAGCACATGAGGACCTGTACCG
CAATGTCTCTCCAAAATATTTGGATTGGGACTACCGGAAGAAGCTTATATGCAAAGAAAT
TAGGGACTATAATCCGGGTATAATGTGTTTCCAGGAGGTTGACCGTTTTGATGATTTGGA
TTATCTCCTCCAGAAAGAGGGCTTCAAAGGGGTTTATCAGGCTCGTACAGGTGATGCAAG
TGATGGTTGTGCAATATTTTGGAACAGCAAACTATTTGACATTCTGCATGAGGAGAGCAT
AGAATTCCAGAATTTTAATCTTCGCAATAATGTTTGCCAACTTTGTGCTTTCAAGATGAA
TGTGAAAAGCTCAAGCAAGGATATGAGTGCTTCAAATTCGGAGAGTGTAACCTCGCCAAG
CTTTTTGGTTGGCAATATTCACGTACTCTACAACCCCAATCGTGGAGACATCAAGTTGGG
ACAGGTTAGACTCTTTCTTGAGAGTGCCCAGAGGCTATCTCATGAATGGGGTGATATACC
AGTCGTGCTTGCTGGAGATCTAAATAGTATGCCTCAGGTAATCTACCTACTCTGGAAAGT
TGGAAATGTTATATTTTGAAGCTTGCAGATCTAATTTTCTATTTGTTGCTGCTTAGAGTG
CAATGTATCAGTTTTTGACTTCAAATAAGTTGGACATCCAAATGCATGACCGAAAGCAAA
TCTCTGGCCAAATTTATCCATTGCAAAATAGAAGCTTCAACCCGAGATTAAGTTATAGAT
GGAGTAATGAAGAGCTAATGCTTGCTACCGGAACAGGAGCTAGTCACTTGATACATCAGT
TACAACTGCGCAGTGCCTATGCTGGAGCTCCTGGAAGCTCTAGAACCAGGGAAAACTCTG
GAGAACCCTTGGCAACATCATATCATTCCAAGTTTATGGGAACTGTCGACTATATATGGC
ACACAACAGAGTTTGTTCCAGTACGAGTTCTTGATACCTTACCTGTTGATATTTTAAGGA
GAACAAGAGGGCTTCCTAGTGAGAAATGGGGAAGTGATCATCTTTCTCTAGTGTGTGAAC
TGGCTTTCACTGATGAAGGGAGTGAGACTTGACTATTCCTTTCGATTTAAGTTAAAAGTT
GAAATACAATTTGGAAGGTCCATCATGCGTGACATACTGCTTCATTGGATAATTCATCGG
TGCATAGAAGAATCTCGCGCAAACAAAAGGAACATAAGTGTACAAGGAGGAACATGGGAA
GGAACGGAAACTGGCGAAGATACATTAAAGGGATTGAAAAGACTATCCATTGTCTGTCCT
CTTCATCTTAGTGATTTATTAATTATAAAATAAATGTTTTATTAAATATAATAAAACCAT
CTGAATTATAGTTTTGCTGGATTCATCTGAAGAAAACTGTTTCTGTTTGTTTCCAACAAA
AGAATGCACTATTCA