Microarray Probes on PGSC0003DMT400014383

Probe IDChipProbe Sequence
CUST_6673_PI426222305 JHI_St_60k_v1 CTCAAGGAGAGAGTAGTACTCCTTTCCGAGACTTTTATTTGTTCAGTTTAGAAAATAAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014383

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014383 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G68320.1 +2 1e-72 230 106/131 (81%) myb domain protein 62 | chr1:25603842-25604884 FORWARD LENGTH=286

Transcript Sequence (1018 bp)

>PGSC0003DMT400014383 1018 pgsc_dm_v3.4
CTGGCTGCTACCTCTTTTGCTTTTGCCTTCAAACAATTATATTTCTAATTAGTCTCTTAA
TATGGAAACAGAAATGTCTTTCTTGTCTAAAAGTTCAAGTAGTAGTTCTAGTGATGATGA
TATTGAATTGAGGAGAGGTCCATGGACTATTGAAGAAGATAAACTGCTTGTTCATTACAT
TACTAATCATGGCGAAGGACGATGGAATATGCTAGCGAAACATGCTGGATTGAAGAGAAC
AGGCAAGAGTTGCAGATTGAGATGGTTGAATTACCTTAAACCGGACGTTAAACGGGGAAA
TCTCACTCCTCAGGAACAGCTCCTGATTCTTGAACTTCATTCCAAATTGGGCAACAGATG
GTCAAAAATCGCGCAATATCTACCTGGAAGAACGGACAATGAAATCAAGAATTACTGGAG
AACGAGAGTGCAGAAACAAGCTAGGAATCTGAAGATTGACTCGAATAGTGCAGCATTTCA
AGAAATGATTCGTTCTTTGTGGATCCCGCGGCTTCTTCAGAAGATACAGAGCTCCTCTGT
TCCGCCATCAATTCAGAGTTCACAATCATCAACCCCTCCAGGTTTCAGCACCAGCACCAG
CAGTAATTCGAGTTCACATTCCTGTAGTATCTATAATTCTCCCAAAATTACCTCAGAATG
TCCTGAAATTACTCCACGCCAGATAGATGATTCTGACTTAAATTCATTCGTCAAGGCTCA
TTTTCCATTTGACAACAGTTATGATATGGATAATTTTGGACAATTAGCAACTGGAAACTT
TAATGATGTGATGGATTATGATCAAATGAGTGGAGATCAAAACAAGTTGACAAGTGACAG
TTTTTGGAGCAATATGGATGAATTTTTCTACCAAAAAACAGGATATGAGCAATTGTAAAT
AGTACTAGTAGTAGTATATGGCCTGATTGAAGCAAGTTTTTTTAAAAAACTGTTTCTTTT
CTCAAGGAGAGAGTAGTACTCCTTTCCGAGACTTTTATTTGTTCAGTTTAGAAAATAA