Microarray Probes on PGSC0003DMT400014233

Probe IDChipProbe Sequence
CUST_52141_PI426222305 JHI_St_60k_v1 CAAAAAAGCCTATATCTGTGATTATGGAACCTAAACTTCCCCTCCATCTTTATTAGAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014233

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014233 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G07990.1 +2 3e-43 115 52/120 (43%) Cytochrome P450 superfamily protein | chr5:2560437-2562859 FORWARD LENGTH=513

Transcript Sequence (750 bp)

>PGSC0003DMT400014233 750 pgsc_dm_v3.4
ATTGAAAGTAAGGCAAGCCAAAGTTGAAAGTGTAACCGTCTATCTATTCGATTCAAGTAG
ATAGACTATTTTCTTAATTTGTTGTTGATACTTGGTATTTTTCGCTATATATCAATGGCA
GAATTTGCTAGCTGGTGGAACAGGTACTGCAGCAGCAACAATAGAATGGACATTTCAAGA
ACTTTTGAGGAGACCAAACATCATGGACAAGGCACACCACGAACTTGACAAAGCCATTGG
AAGAGAACGATGGGTAGAAGAAGAAGACTTTTCTAAGCTACCTTATATAGATGCCATAAT
CAAAGAGTCATTTAGACTTCACCCTTTAGGTGCATTGCTTCCTCCTCATTACTCCATTGA
GGATTGTAATGTTGCTGGTTATGACATACCAAAAGGGACAATTGTTTATGTAAACGCATG
GTCTTTAGGAAGAAATTCAAAGTATTGGGATAGGGCAGAAGAGTTCATTCCAAAAAGATT
CATAGAAAATAACATAGACATAAAAGGACAATTTCGCATTGTTGCCATTTGGTTCAGGAA
GGAGGAGGTGCCCGGGGTATAGCCTTGGTATGAAGGTTGTTCGAACAACAATGGCTAACT
TGTTGCATGGATTCAATTGGAAATTAGCAGGAGATATGAGGCCAGAAGATATAAGCATGG
AGGAGATTTATGGATTAACTACACACCCAAAAAAGCCTATATCTGTGATTATGGAACCTA
AACTTCCCCTCCATCTTTATTAGAGCTAGC