Microarray Probes on PGSC0003DMT400014232

Probe IDChipProbe Sequence
CUST_52140_PI426222305 JHI_St_60k_v1 AGCTTATTGTGAGTGTTATCTTGTTCGTATATGCATATTCTTTGCCTTGGCCAATTCAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014232

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400014232 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G07990.1 +3 1e-114 355 194/505 (38%) Cytochrome P450 superfamily protein | chr5:2560437-2562859 FORWARD LENGTH=513

Transcript Sequence (1796 bp)

>PGSC0003DMT400014232 1796 pgsc_dm_v3.4
CAAAGATGGAAATCTCTTGGGTTTTCATAGTGTTTGGGTCATGGCTACTAGCATTAGCTT
TTGTCTTAAAAATATTCAACCATCCGAAAAGGAAAGTACCACCAGGTCCAAAGCCATGGC
CAATTATTGGCAATTTGAACCTCCTTGGTTCACTCCCACATGAGTCTTTGCACCATCTTT
CACAAAAATATGGAGATTTAATGCTACTAAAATTCGGTTCAAAGCCTGTTTTGGTCGCAT
CATCTCCAGAAATGGCTAAAGAGATATTGAAAACACATGATACTATCTTTGCTTCTCGCC
CTCCATTAGCAGCTGGTAAGTACACTGGTTTTAACTACTCAGACATGCTATGGGCATCTT
ACGGTGCATATTGGCGTCAAGCTAGAAAAATTTGCCTAACCGAGATATTTAGTCCCAAGA
GGCTTGATTCATTAGAGTATATTCGTATTGAGGAAAGACAAACTTTGATTTCTCGTCTTT
TTCCTCACTCAGGAAAACCAATTTTGCTTAAAGACCATTTATCTAGATTTACTCTTCGCA
CTATAAGCAGAATGGCTATGAGTGACAAATATTGTAGTGATCAGTCAAACTCAGATACTT
CAATAGCAACACTTGAAAGATTGCAATGGATGTTGGATGAGTGGTTTGTTCTAGGTGGGG
TGATGAATCTTGGAGATTGGATACCTTTGTTTAGTTGGTTTGACTTGCAAGGATACGTAA
AGCGAATGAAGGCATTAGGGAAGAATTTCACAGAATTTTACAAATATGTACTTGACGATC
ACAACGCAACAAAGATGCAAACAACAGGGGATTTTGTTCCAAAGGACATGGTTGATGCTC
TGTTGCACCTTTCTAATGACCCTAATCTTGAAGTTAAACTTACTTCTGATCACATGATGG
GACTAATAAATAATTTGCTAGCTGGTGGAACAGGTACTGCAGCAGCAACAATAGAATGGA
CATTTCAAGAACTTTTGAGGAGACCAAACATCATGGACAAGGCACACCACGAACTTGACA
AAGCCATTGGAAGAGAACGATGGGTAGAAGAAGAAGACTTTTCTAAGCTACCTTATATAG
ATGCCATAATCAAAGAGTCATTTAGACTTCACCCTTTAGGTGCATTGCTTCCTCCTCATT
ACTCCATTGAGGATTGTAATGTTGCTGGTTATGACATACCAAAAGGGACAACTGTTTTTG
TAAACGTGTGGTCTTTAGGAAGAAATTCAAAGTATTGGGATAGGGCAGAAGAGTTCATTC
CTGAAAGATTCATAGAAAATAACATAGACGTGAAAGGACAAAATTTCGCATTGTTACCAT
TTGGTTCAGGAAGGAGGAGGTGCCCAGGGTATAGCCTTGGTATGAAGGTTGTTCGAACAA
CAATGGCTAACTTGTTGCATGGATTCAATTGGAAATTAGCAGGAGATATGAGGCCAGAAG
ATATAAGCATGGAGGAGATTTATGGATTAACTACACACCCAAAAAAGCCTATATCTGTGA
TTATGGAACCTAGACTTCCCCTCCATCTTTATTAGAGCTAGCTACAGAAGATATAAGCAT
TAAGTTAAAATATACTCCACTTTTTGATGAAGCAACACTTCTTGCTCCATTAAGTTAAAA
TAAAAATGGCACAAGTGTTCACTGCCTCTTTTGAACTTCACCATTTTAATTCTTGCTTTT
GCTATCATAAGGACATAACGATTGTCTTACTTTCATCGTTTAAATGTTTTGAGTGAAGCT
TATTGTGAGTGTTATCTTGTTCGTATATGCATATTCTTTGCCTTGGCCAATTCAAG