Microarray Probes on PGSC0003DMT400013972

Probe IDChipProbe Sequence
CUST_41676_PI426222305 JHI_St_60k_v1 GACTCTAGGAGTTTTGAGGTTGTGGGAAACCAAATGGTGGTTTTATTTTTAAGCAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013972

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013972 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G37730.1 +2 2e-24 101 55/89 (62%) basic leucine-zipper 7 | chr4:17723800-17724717 FORWARD LENGTH=305

Transcript Sequence (1144 bp)

>PGSC0003DMT400013972 1144 pgsc_dm_v3.4
AAAAAAGTAGAATTACTTGTTACTACCCCACCCCAATAATGCCACCTGACTCAAAAGTCA
AAAGTTATACAATGACCAAAATACCCTCAAATAACCCCTACCCTCTTCCCCTTTAAATAC
TACACTCTTCACCTAGTTTCATCCCTTTTCTCCTTCTATCTTCCCACCCACCCCCTCTAT
AAGAATTTTTCCGATCATGTTGTCCACTATTCTGTCCTCTGATGGGCTTTTTCCGAACAC
CTTCCCTTCTTTGTACGATGATTTCACTCAATGGGATTACATCGAACCGACTTCTATATT
CCCTGAACCAGGGGTAGAATCGGTATTTTCACCAATGCAATCCCCAACCCCTGAACCGGT
AATTTCACATGACTCCGGTTCAGGCTCTGACAAATCTAAACCCGATTCTCCTAACGATAG
CCCAAATCCCGGGTCGGATGATTTGGCTGAGAGAAAACGAAAGCGTATGATATCGAATCG
CGAATCAGCTAGGCGATCCCGCATGCGTAAGCAAACACATTTGGAGAATTTGAGGAACCA
ATCGAACCGGCTTAAACTTGAAAACCGGGATTTAACGAACCGGGTACAGTTGGTAACCGG
TCATTACCAACTTGTTGAGAGAAACAACGAGATGCTCCGAGCCGAATCGATTTTACTACG
ACAAAGACTCGAGGGCATACATGACATCTTAATCACACGACAACTTCAACAGCAATTGTA
CAATTCCGCCTTTGCAATAAGGCCATGCAATAATTTATACGTGGAACAAAGACCACATAT
CATTAATCAACCTATAATAAATCATCAATAAAACATGCTTTGCCAAAGGGAGAATCTTCG
AATCTATGTTGTTCGAACATTTTAAAAATGTTATCATATCTGACGACATTTTTAAAATAT
CTGAATAACATAGTTTTAAAGCGCTATATACCTCAAACATGGATAGATGGACCAAAAGAG
ATAAATAATTTCTTTCTCACTCTCTATCTATTTCTTGTAAATTAAAAGATGTTAATAGAA
TAAAATCACTATAGACTCTAGGAGTTTTGAGGTTGTGGGAAACCAAATGGTGGTTTTATT
TTTAAGCAAAAAAACCAGTCATTATGGTGTGTACTAAAAGACTTTATGGATTGTCTAATT
TGGC