Microarray Probes on PGSC0003DMT400013961

Probe IDChipProbe Sequence
CUST_50925_PI426222305 JHI_St_60k_v1 GGTGCATTTGGCAAGGAAAGTGTAAACGATCTAAGAAAGTTTTATGGACTTATAAGGATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013961

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013961 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46620.1 +1 4e-90 281 172/318 (54%) P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr2:19139071-19140546 REVERSE LENGTH=491

Transcript Sequence (954 bp)

>PGSC0003DMT400013961 954 pgsc_dm_v3.4
ATGGAACAGGATTTGAAGAACAAGGTCAAAGCCGATTTGGAAACGTTCCTAAAATCAAAG
CAGCATTATAATCGAATCGGCCGGATTTGGAAACGGAATTATTTACTTCACGGACCTTCC
GGTACAGGAAAATCAACGTTCATTGCAGCAATGGCAAATTTCCTAAGCTACGATGTGTAT
AACATTGATTTATCAAAAGTTTCAGACGATTCAGATCTGAAACTACTTCTATTGCAGAGC
ACGAATAAGTCATTGATTGTCATTGAAGATCTCGATAGTTACCTGTGTAACAACTCAACA
GCTCTAAGTTTCTCGGCGATTCTCAATTTCATGGACGGAATTTTTTCATGCTGCGGTGAC
GAACGTGTTATGATATTCACGATGAACAGCAAAGATCAGATTGATCCAGCAGTTCTAAGG
CCTGGAAGAATTGATCATCACATACACTTCCCCTTGTGTGATTTCAACGCATTCAAAAGT
CTAGCTAACAGTCATTTGGGATTGAAAGATCACAAGCTTTTCCCACAGGTAGAGGAAAAT
TTTCAAACCGGGTCGGTTTTAAGTCCGGCTGAAATCAGTGAAATCATGATTTCAAACCGG
AGTTCACCGAGTAGGGCATTGAAATTAGTGATTTCTACTCATCAGAGTAACAGCAAGCTC
GTCCCTTCGAGAACATCCGATAAAATTGAAATGATACACAATAACATTGAGGCTGACTTA
GCTCCTAAGCATCCACTATGGTTGAGCAAATCTAGATCGGTTCGACCCGTGGAGGAATCA
AGTGAGTCGGATAAGTATCCACAAGGATTGATCAAATCTAAATCGGTTCGACCCATGGTG
GAGTCGGGTGCATTTGGCAAGGAAAGTGTAAACGATCTAAGAAAGTTTTATGGACTTATA
AGGATAAAGAGTAGTAGGAAGAAATCTTTAGATTTTGATACCTCAGAAAAATAA