Microarray Probes on PGSC0003DMT400013822

Probe IDChipProbe Sequence
CUST_17243_PI426222305 JHI_St_60k_v1 TGACTATCATTTTCCTGCTCCTTGGGTAGGACCATTGAAGAATGCAATTGATTGGGCCTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013822

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013822 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G27890.1 +3 9e-34 124 67/88 (76%) NADPH:quinone oxidoreductase | chr3:10350807-10351938 REVERSE LENGTH=196

Transcript Sequence (846 bp)

>PGSC0003DMT400013822 846 pgsc_dm_v3.4
TGTTACTACAATGGGTGTGACCGCTTGAGTTGAGGTAATCATAGTCTGTACATCTTAATA
CAAACAGAGAATTTGGTCCCCTAGTTTAAATCCAAACCATTTTAATCTGAAAGTATCGTA
GATTAGGCTGTGGATATGCAAGTAGCTATAGGTTGGTAAACTAGTGTTGATGGATTTTTA
CTTCTTGTGATGACACTCTTGGTACTGATGACTATCATTTTCCTGCTCCTTGGGTAGGAC
CATTGAAGAATGCAATTGATTGGGCCTCCCGACCTCCAAATGTTTGGGCTGATAAAGCAG
CAGCAATGGTGAGCGCTGGAGGTGGCTTTGGTGGAGGACGGTCACAATATCACCTCCGAC
AGATAGGAGTCTTCCTTGATCTTCATTTCATTAACAAACCTGAATTTTTCCTGAACGCGT
TCCAGCAACCACCAAAGTTTGACAGTGATGGTGTGCTGACAGATGAAGAGACCAAGCAGA
GACTCAGAGCAGTTCTTTTGGCTTTACAAGCACTTGCCTTGAAACTCAAAGGCAAGTGTG
AATAGTTTCTACCAGTAAATGTGGTCCATTTCTTCATCCAATGTGGATGGTAAAGAATTG
ACATTTCCACCTCACATGGGAAAAAATATCTACTTATAGACTTTTGAAACATCTGTTCAG
TTGATTGAGCGTGTTAGCAGGATTTAAATTGTATTCAAAGTTTCATGGTGATTGATGTAA
TGGCTCCAACATGTTTCTGTCTTTCGTTTTCTGTTCTGTCAGCATTACAAAATATCATCA
ATACATATACTTCGAATAGACTAGTGGTCCAACATGTGTTCATACCCAAGTTCAGCTCAC
CCCTTG