Microarray Probes on PGSC0003DMT400013810

Probe IDChipProbe Sequence
CUST_17225_PI426222305 JHI_St_60k_v1 CTGTTGTATACCATAGGAGTTGGAAAGATTCGATTACGAAGGGAAAAAGGAATTATAAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013810

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013810 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G56710.1 +3 4e-08 52 25/49 (51%) sigma factor binding protein 1 | chr3:21007053-21007508 REVERSE LENGTH=151

Transcript Sequence (1078 bp)

>PGSC0003DMT400013810 1078 pgsc_dm_v3.4
TTTATACCTCTCAAACAAATTCCATTTCTCATTCACTTTATCATCGTACTATTAACTACT
TTCTAGTTGAAATCTAAGGCTCTGCTGATCAAGTTAGTTATCGTAAACTAATTTGAGATT
GAGGCGTAGTTATGATAATGAACAACAAGAAACAAAAGAGAAAAAACGATCATAGATCGA
AGAAGCCAGATGTCAAAGTTGTGTACATTTCTACTCCGATGAAAGTTAAGACAAGTGCCT
CGAGATTTAGGTCACTTGTACAAGAACTCACGGGACGGGACTCGGATATAGAGAGAATTA
TGGAGACTAATGGGTCGATAACGGAGTATGAAGATATTCATCGTGAACGCGATGATTTTA
ATGAACTTCCAACAAAGTCGTCATCACTATCACCATCACCATCATCGTCATCGTCTTTGC
TGCTAGCAAAATCATCTAATTCATCTCCTATGAGTTCAGAATCTAATAATTATTTTATGG
AGCCTAATTTTGATGATTTATTTAACAGCCAAATGGAAGAGCAATTCCTTGCTTTATTGG
CTTCATCAAATTATAATTTGCCACCTAGTAGTAGTGATTATTCAGCTGAGATTGATGTAC
TTGGAAGCTATGATGCACTACTTTAGATTTATTTTGTTTTATTTTATTTTTGGATAATTA
GGTGGGTAGATACGATCGACTTAATTAAGAGGTGTATGTATGTATATATGTATGTATTTT
TTTATATGCTAAGCGGATATTGTTTAGATAGTATTGTATCATCAGTATAACTTATATACT
ACTGTTGTATACCATAGGAGTTGGAAAGATTCGATTACGAAGGGAAAAAGGAATTATAAG
TAATAAATATTGGTAGTAGAAAAACTTTATATATATTTCGGAAAAGGGTCAAAATTGCCT
CTGAACTATGTGAAATAGACCACTTATACCCTCCGTTACATTTTGAGCTCAAAAATACCC
TCACTCTTATCTCTAGAGACCACAAATACCCCTCAAAAGTTAACAACCCAAATTTTTAAT
GACATGGCAAGCCATGTGTGACTGATCCTTCCACCTAAGCTGCCAACTAGGATTACCA