Microarray Probes on PGSC0003DMT400013096

Probe IDChipProbe Sequence
CUST_49875_PI426222305 JHI_St_60k_v1 GATCTAGAAGAACAACCGGACTTTGATTCCAAGTTGGAACTTCCAACTGATCATGAATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013096

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013096 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G33720.1 +1 6e-42 138 61/92 (66%) CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein | chr4:16182813-16183304 FORWARD LENGTH=163

Transcript Sequence (339 bp)

>PGSC0003DMT400013096 339 pgsc_dm_v3.4
ATGCAACACTCTGGTGGCCCTTACGGCGAAAACCTAGCTGCCGGTTTCCCCCAGCTCAAC
GCGGCTGGTGCTGTGAAGATGTGGGTAGATGAGAAGCAATGGTACAATTATAATTCAAAT
ACTTGTCAAGCTGGTAAAGTATGTGGACACTATACTCAGGTAGTGTGGCGTAACTCAGTA
CGTCTCGGTTGTGCTAGAGTCAGGTGCAACAACGGGTGGTACTTTATAACTTGCAATTAT
GATCCACCAGGTAACTGGAACGGTCAACGTCCTTACGGTGATCTAGAAGAACAACCGGAC
TTTGATTCCAAGTTGGAACTTCCAACTGATCATGAATAA