Microarray Probes on PGSC0003DMT400013077

Probe IDChipProbe Sequence
CUST_49862_PI426222305 JHI_St_60k_v1 GTAATGTATTTCACATCCAAATTACTTATACAAACTGAGCAGTTGATCTACCCTACAACC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013077

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013077 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G09970.2 +3 0.0 971 540/949 (57%) Leucine-rich receptor-like protein kinase family protein | chr1:3252408-3255428 FORWARD LENGTH=977

Transcript Sequence (3309 bp)

>PGSC0003DMT400013077 3309 pgsc_dm_v3.4
CTCATGGCCACCCTCTTGAGAAAAAATTCTCCACTTTCTCTCTCGTGGATTTCATGTTCC
CACAGAAACCAAACATCAAACATAGCCATATCAAACTTTCTTCTCTATTCTTCTTACTAG
CGAAAAAAAAAAAAATGTCAGCCAGTGCCAACTTTTTCCGGCCATGCCCAATTTTATTGC
TCTGTTTTTTCATATTCTTGATTTCTCCTTCTCATCAACAAGATGAGTTACAACTCCTTA
TGCAATTCAAATCCACTCTGAAAACAACACAAATTTCACATCTTTTTGACACGTGGACAC
CTCAGAATAACATTTGCAACTTCACTGGAGTTTTCTGTGATTCTGACAGTAAATTGGTTA
AAGAAATCATTCTTTCTGAACAGAATCTATCTGGGGTTGTCTCTTTTGATTCACTATGCT
CTCTGAAATCACTAGAAAAAATTTCTCTTGGTACCAACTACTTGTATGGTAGAGTCAGTG
ACCATTTGAAAAACTGTACAGAGTTGCAGTATTTGGATTTGGGTAACAATTCTTTTTCAG
GGGAAGTTCCAAATTTGTCTTCTTTAAGCCAATTGGAGTTTTTGAATCTCAATAGAAGTG
GATTCTCTGGTTCATTTCCATGGAGTTCACTTGGAAATCTTACTAGTCTAACTTTCTTGA
GTTTGGGTGACAATTCATTTAATAAAAGTCCATTCCCTCTTGAAATCTTGAATCTTGATA
AGTTATATTGGGTTTACCTTACCAATAGTAGTATTGAAGGCCAAATTCCAGAAGGTATTG
GAAATCTTACTCTGCTTGAAAATCTTGAGCTTTCATATAATGACTTGTCAGGCAAAATCC
CAGATGGAATAATCAAACTTACTAAGCTTAAACAGCTTGAGATTTATTCTAATGGACTAA
CAGGAAAGTTCCCTGTGGGGTTTGGGAATCTCAGTAGCCTTGTCAATTTTGATGCTTCAA
GTAACAATCTTCAAGGTGATCTTTCAGAGCTCAAGTCTTTATCTCTTCTTGAATCTTTGC
AGCTGTTTGAAAACCATTTTTCTGGTGAGATTCCTGTTGAATTTGGAAATTTCAAGTTTA
CAGAACTGTCATTGTACAGAAACATGTTTTCTGGTTCTCTTCCTCAAAATATTGGATCAT
GGGCAGAACTTCAGTACATTGATGTTTCTGAGAATATGTTCACTGGTTCAATACCACCTG
ATATGTGCAAGAAAGGGAGTATGACTGATCTTTTGCTTCTCCAGAACAACTTCACTGGTG
GGATACCTTCGAACTATGCTACTTGTTTGTCGTTGCAGCGTTTACGGGTTAGCAACAATT
CACTTTCAGGAGTAGTCCCTAGTGGAATTTGGAGTTTGCCAGATTTGGAAATCATTGATC
TCACATTGAATCTATTTGAAGGCCCAGTGACATCCAATATTGGTGAAGCAAAGTCTTTAG
CACAGTTGTTCCTAGCCTACAACCGGTTCAATGGTCAATTACCACAGACAATATCAGAAG
TTTCTTCATTAGTAGCCATTAATCTGAGCGCGAATCAGCTCTCTGGTGATATTCCAGCAG
CAATAGGTGAACTTAAGAAGCTTAATACTCTTCATTTAGAGTATAATTTGTTTTCTGGAA
GTCTTCCAGATTCTATTGGATCATGTGTTTCTCTCTGTGAAATTAATCTTGCTGGTAATT
CACTTTCTGGTGCAATTCCCGAAAGTCTTGGCTCTTTGCGTAGCTTGAACTCTCTCAATC
TATCTGATAACACGCTCTCAGGTCAAATTCCAGCGACCCTTTCGAGTTTAAGATTAAGCC
TTCTTGATTTGTCAAACAATAGGTTGAGTGGTAGCATACCGGATTCTTTATCAATAAAAG
CTTTTAGTAATAGCTTTTTGGGAAATCCAGATCTTTGTAGTGAGAATTTTGGTAGCCTCA
GGCCATGTTCATCAGATCCTCACACATCTAGAGACCACAGGACAGTCATGTTGTGCTTGA
TAGCTGGGGTAGTTGTTCTTGTTCTGTCACTTACGTGTTTCGTGTATGTGAAGTTTAAGC
ACAATAATCAGAACACTCCCGTAAAGAGACTTGATTCTTGGGATATCAAACAGTTTCATG
TATTGAGCTTTAGTGAAGATCAAGTCTTGAAGGCATTGAAGCAAGAAAATTTGATTGGAA
GAGGTGGTTCAGGGAATGTGTACAGATTAGTCTTGAATTGTGGAAAACAGTTGGCTGTGA
AACACATTGTTAAATCCGATTCTGGTGACCAAAAAAGTTACCGGGACAGCTCAGCCATAC
TGGTGAAGGAGAATAGAAGATCAAAGGAGTATGATGCTGAGGTGACCACGTTAAGTTCCA
TTAGGCATGTCAATGTTGTCAAATTGTACTGTAGCATCACAAGTGAGGACTCAAATATGC
TGGTTTATGAATACTTAACTAATGGAAGCTTATGGGACCGATTGCACACGTCTCAGAAAG
TCAAGATGGATTGGTTGGTGAGATATGACATTGCATTAGGTGCTGCTCAAGGGCTTGAGT
ATCTGCATCACGGATATGACAGCCCCGTGATGCACCGGGATGTCAAGTCTAGCAACATCT
TGTTGGATGAACAGATGAAGCCAAAAATTGCTGATTTTGGATTAGCCAAAGTTTTGCATG
TTAATGGTACTAAGGACTCTTCTCAGGTTGTAGCTGGGACGCATGGCTACATTGCTCCTG
AGTATGCTTACACAACCAAGGTGACCGAGAAGAGTGATGTTTATAGCTTCGGGGTGGTGC
TAATGGAATTGGTGACTGGAAAGAAGCCAGTGGATGCAGAGTTCGGGGAGAACAGTGACA
TAGTCCAATGGGTTTGTAGCAAGATAAGAAACAACACTAGCATGATCGATTTGGTGGATT
CAAGCATTTTCGAGGGGTTCAAAGAAGATGCTGTTGAGGTTCTTAAAATTGCAGTTCATT
GCACATCAAGGACGCCAGCATTAAGACCTTCCATGAGGATGGTAGTTCATATGCTAGAAG
AAGCCGAGCCTTGCAAGCTGACAAATGTAGTCGTAAATTCACCGAATGAGGATGGCAGGA
AACAAGGACTTGCTAACTAATGGCAAGTCATGATGTTGAACTATCTCGTTGAGAGCAATG
GAATTTTGCAGAATATTGAACTATGTTGTAAGTTCACAAAGAATGCTTAGTGTACATATG
ACACTTTTGAAGAAATAGTGTATTTCACAGCTGCATTAATAAATCCAACTAGCAAGTAAT
GTATTTCACATCCAAATTACTTATACAAACTGAGCAGTTGATCTACCCTACAACCAATTT
CATTTTTCT