Microarray Probes on PGSC0003DMT400013055

Probe IDChipProbe Sequence
CUST_5952_PI426222305 JHI_St_60k_v1 TTTGGGTTTGATCTCAACTTTCTGTAGTTCATTTTGTTCAATAAGAAATGTGGATAGCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400013055

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400013055 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G06880.2 +2 1e-61 231 197/798 (25%) Transducin/WD40 repeat-like superfamily protein | chr3:2170516-2175686 REVERSE LENGTH=1264

Transcript Sequence (4196 bp)

>PGSC0003DMT400013055 4196 pgsc_dm_v3.4
TGTACTTTTAGCTCCACTTCACCAAAGTCAAAAAGACTTTAGTTCTATAGCTCCAAAAAC
TTTTGTAAAACCATTTTCGTTTCACATGGCTTCAGAGAGCATTCTCCGCCACACCAGCGT
GTTCTTATCGGAAATTCTTGCTCATTCTGAGCTCCGTCACTGGCTATTCTCACTCTTTCA
TCAATCCGCTGATCAATCTGTTGCAATTGAAACTATAGAAAATGCAGCTTCCACTTCCAA
TTACTCCTCTCTCAAACTAGCTGCTGAAAAGATCCTTGTTTCATTAGACTCTGAAAACAC
ATTTTCTTCCTTTTTGTTATCTCTCGTTTATACTCTTCTGCATAAACCCGTAGATGCTGC
TCTTAGTCTTCTTCATGTGTTTTACACTGATCCTTTCATTGCAAGAGTGGAAATTGCACC
TCTTGTTTTTGAACAATTGTTTCTCATTCATTTCATTCCTATTCTTCACTGGTACAATCA
CCAAAGGTCAACAATTATGCCATTATTCAACGCGGTTTCAGCACCTACCAAGTCTTTGTC
AACTATAAGCAGAGAGCAAGCCTCTCAGTTGAAGGATTTGGAGAATGAGTACGAGGAAAT
TCTTGATGAGAATTGTAGAGTTTTTTCTCGATATTTCAAGGAGGTTTTGCGAGCCAAATA
TCAAGACAAGATTATTGATCCACCATCTGTAATTGTACAAAGGAGTGACTGTTTTGAGTT
TAGCAAAGATGAGGAGATGATCAATCAAGAATATGGATTGAAAAATCGACGGTATAATCC
AATATGGACTGATTCTGTTGAAGGAGACAAGTCAGTCATGAAATTGAATAGTAGTAGCAA
AGAGTTTTCCAAGTTTCCGTCTTTTTATCCTCAGAGAGTTTCCCTGAAAGTTCTTACAAG
TCAAAGATCATCAATAAAATCAAAGCCATCCAATTTTGATTTGGAACATCAGTCTTGTTC
AAGTGATGATTCCAATGATCCTTGTTCCACTGAATCCAAGGGCGAAAATGAGGATATGAA
CAAAATAATGTCATTGCTCATCACAAGGCAGACGCAATATCTAAACGAGAAGCAGCCTAT
TGTCAGAGAATCAAGCTGCCATCCAGATTCTTTAATGGAATCCAGTGGAAAGAATACACC
ACCAAAGGATTTTGTATGTCCCATAACTACACATGTACTTGAAGATCCAGTGACTCTTGA
AACTGGTCAGACATATGAAAGAAAGGCTATTCAAGAATGGCTGGAGATGGGAAATGCCAC
TTGTCCAATAACACGGCAGAAGTTACATAGTACTCAACTACCGAAAACAAATTATGTGCT
CAAGCGCCTCATTGCAAGCTGGCAGGAAAAGGACCAAAATTCAGCTCCTCTTCATAGGTG
TGAGCCTGAATATCAACCAGTAAAGAGACCAGGTCCACGTACTAGTTTAGGAGGCCTAGG
TTCTTTAGATGGAACCATCAGTGAGCTTCGTCGTACAATAACCAACCTCTGTACATCAGA
GATTCTAAGAGAGTCTGAAATGGCAGTGCTACAAATTGAGCAGTTCTGGAGAGAAGGTCA
GATGGTTGATATTCAGGAGATGCTCTCAAAACCTCCAGTTATCAATGGTTTTGTAGAGAT
CCTTTCCAATTCTGTTGATCCCGATGTTTTGATGGCAACGATATTTCTCCTCTCCGAGCT
GGGATCAAGAGATAATGGTGTCATCCAAACACTGACCAGAGTTGACACTGATGTAGAATG
CATTGTTGCTCTTTTTCAGAAGGGATTACTGGAAGCTGTTGTTCTGATCTATCTATTGAT
GCCATTTATTGGAAATCTTGCAGAAATGGAATTGCTGGACTCTCTTCTAAAAGTTCTCAT
CAGTCGTGAGGAAGACTTGGTTAGCATGTTTATGAAGCCCAAATCAGCTTCAGTGCTTCT
TCTTGGACATGCTCTTAAAAACATAGAGGATGAAAGAGCTTCCAAAATTGTCAAGGGGTT
GACTTCGGCAAAAGTAGTAGAGTCTATTTTATGCAGCTTGGAAGCTGAATTAGTCGAAGA
ACGACTATCAGCTGTGGTTATTTTATTGAGATGCATGCAACAGGATGGAAGATGCAGGAA
TATGATAGCTGATAAAGCTGAATTAACACACCTGTTAGAGAGCTTCATTGAGTCGAACGA
TGCAGATAGGTTTGAGATTATCCAGTTCCTATCTGAACTGGTCAAGTTAAACAGAAGGAC
ATTTAATGAGCAAGTGTTGCACATTATTAAGAATGAAGGTACTTATAGCTCAATGCACAG
CCTCCTCATATACCTACAGACAGCTCTCCCTGATCAGTGTCCTGTTGTGGCTGGCCTACT
TCTACAACTTGATCTGCTTGCAGAACCAAGGAAAATGAGCATCTATAGAGAGGAAGCTGT
AGATGTCCTAATTATGTGTCTCAAAAATTCAGATTATCCTGACTCTCAAATAGCTGCTGC
TGAGACACTTTTAGCGCTCCAAGGAAGGTTTTCCTATTCTGGTAAACCTCTTATTAGGGA
GTTTCTACTTAAACGTGCAAGACTTGACCGGACAGATCATAGCAATGCAGCGCAAAATGA
TACTGGATATCTGTCTAGTAGTCAAGAAGCAATGGAAGAAGAGTTAGCTGCTGAGGACTG
GGAGAGGAAAATGGCATTTTCTCTGGTCAGCTATGAATTCGGATTACTATTTGAAGCTTT
AGCAGATGGCCTGAAGAGTAAATCAGCAGATTTATTTTCTGCATGTTTTCTGTCTGCTAC
TTGGCTGGTATACATGCTGACCATCCTTCCAGACACTGGAATTAGAGGAGCAGCAAGAGT
ATGCTTGCTCAAGCAGTTTGTATCAATATTCAAATCTTCAAGGGATACAGAGAATAAAGC
ACTTTGCTTGCTTGCACTGAGGAGCTTTATCAGTGAGCCTGAAGGACTGCATGATCTAAC
AATCCATGTGAAGGATATACTTAAAGGTTTGAGAGAACTAAAGAAATCATCCACCATGGC
TGTTGAAGTTTTTAACCTTTTTTCAGAAGAGCGAGAATCTAGTGCTGATATGTGGAATCA
TAAAGAAATTGCACTGGAGGATTGCAGTGTTAACGGTGAAGTCTCTTCAATTGTGTGCTT
CAGAAATAAAGTTTTTTCCAGTCATACAGATGGAACTATAAAGGTATGGACAGTAAAAGC
TAAAAGCTTACACCTCATCCAAGAAATCCGAGATCATCTCAAAGCTGCGACAAGCCTGGT
AGTTCTACAATCAGGAGAAAAGTTGTACAGTGGTTCACTTGATAGAACTGTGAGGGTGTG
GTCCATCCAGGATGAAGGAATAGAATGTGAAGAAATTCATGAAATGAAGGATCATGTCAA
TAACCTAATGGTCTCAAACAGCTTGTCATGCTTCATTCCTCAGGGAGCTGGCATTAAGGT
GCATTCATGGAATGGAGCAACCAAACTTTTAAATCAACAGAAGTATGCAAAATGCCTGAC
TCTTGTTAAAGGAAAACTGTATTGTGGATGTGTTGATAACAGCATTCAGGATATTGATTT
GCCAACTGGAACAATTAACTCTATTCAAAGCGGCTCAAGAAAATTATTAGGGAAATCAAG
TCCCATATACGCCATACAAGTTCATGATGGACAACTATTTTCCGCAGCTACTTCCTTAGA
TGGAGCAGTTGTGAAGATATGGAATACATCAAACTACAGCATGGTTGGATCATTGCAATC
CACATTAGACGTTCGCACAATGGCTGTCAGTTCAGAGCTGATTTATTTAGGGGGGAAAGG
AGGAATTGTGGAAGCCTGGTGTAAAAAGAAACATAATAGAGTGGAGACACTACAAACTGG
TATAAATAGCAAAGTTGTTTGCATGGCTCTTGATACTAATGAAGAGACTTTAGTCATCGG
AACATCTGATGGCAGAATTCAGGTAGACGACTACTTTTCTTTCACTTCAATTAGTATCTT
ATAGTGATATCCTTTGAACTAAAATACGTTCTGCAGGCTTGGAGACTGAGTTGAAGTACA
ATGGTGTAATCAGCTGGTTTATCAACATTCTTTTCAGGAAATAAGCAACGAAAATGCCTG
TATCAACAATGTTACTAAAATATGTACATAGTTGAATTCGTTATATCAATAAACTCTTTG
GGTTTGATCTCAACTTTCTGTAGTTCATTTTGTTCAATAAGAAATGTGGATAGCCG