Microarray Probes on PGSC0003DMT400012547

Probe IDChipProbe Sequence
CUST_33909_PI426222305 JHI_St_60k_v1 GGCGAAGGTAAAACTAACCTAACTTGATGAATGAGAGATTTTTACTGATACGTGATGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400012547

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400012547 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G53910.1 +3 2e-79 254 171/407 (42%) related to AP2 12 | chr1:20135242-20136581 FORWARD LENGTH=358

Transcript Sequence (1480 bp)

>PGSC0003DMT400012547 1480 pgsc_dm_v3.4
AGTACATTCTCTCTTCAAATTGAACTTTTTCTCCATTAAAAATTTCTCTGCAATTTTTTT
TTTTTTTTTACAGTTTTGAGAAGAAAGCAAAAGCTATGTGTGGTGGTGCAATTATCTCCG
ATTTGGTACCTCCTAGCCGGATTTCTCGCCGGTTAACGGCCGACTTTCTATGGGGTGCAT
CCGATCTGAACAACAAGAAGAAAAACCCTAGTAATTACCACTCAAAGCCCTTGAGGTCTA
AGTTTATTGACCTTGAAGATGAATTTGAAGCTGACTTTCAGCACTTCAAGGATTACTCTG
ATGATGATGAGGATGTCAAGGCCTTTGGCTCCAAATCTGTGAGATCTGTTGATTCAAACT
GTGATGCTGACAGATCCTCCAAGAGAAAGAGGAAGAATCAGTACCGGGGTATCAGACAGC
GTCCTTGGGGTAAGTGGGCAGCTGAAATACGTGATCCAAGGAAAGGGATTCGAGTCTGGC
TTGGAACTTTCAATTCTGCTGAAGAAGCAGCCAGAGCTTATGATGTTGAGGCGCGAAGGA
TCAGAGGCAAGAAAGCTAAGGTGAACTTTCCTGATGAAGCTCCAGTGTCTGTTTCTAGAC
GTGTTGTTAAGCAAAATCCCCAGGAGGCACTTCGTGAGGAAACCCTGAACACAGTTCAGC
CTGACATGACTTATATTAATAACCTGGATGGTGGATCCGATGAATCGTTCAGCTTTTTCG
AAGAGAAACCAGCAACAAAGCAGTACGGCTATGAGAATGTGTGTTTTACTGCTGGAGATA
TGGGACTGGGTTCAGTTTCCCCTTCAGCTGGTACAAATGTTTACTTCAGCTCTGATGAAG
GAAGTAACACTTTTGACTGCTCTGATTTCGGTTGGGGTGAACCGTGTGCAAGGACTCCAG
AGATCTCATCTGTTCTGTCAGAAGTTCTCGAAACCAATGAGACTCATTTTGATGAAGATG
CCAGACCAGAGAAAAAACTGAAGTCCTGTTCCAGCACTTCATTGACAGATGACGGTAACA
CTGTGAACACGCTATCTGAAGAGTTATCGGCTTTTGAATCCCAGATGAAGTTCTTGCAGA
TCCCATATCTTGAGGGAAATGGGGATGCATCAGTTGATGCCTTCCTCAATACAAGTGCAA
TTCAGGATGGTGGAAACGCCATGGACCTCTGGTTCTTCGATGATGTACCTTCTTTAATGG
GAGGCGCCTACTAAGCTGCATAAACGTCTTCCCTTGCTAAGTTTTGTAAATAACGCTTCA
TTTGAGTGAAGTTTGCGTTTGCGTTTACGTTATCTCCAAACCAAGACTAATATGTATTGT
ATTAATTTATTCAAAACTTTACTCGTTTGATATATGTAAGTATGTATCCTTGCTTTCATT
AGTCGATGGTTTACAGTCACAAATGCGTTGGCGAAGGTAAAACTAACCTAACTTGATGAA
TGAGAGATTTTTACTGATACGTGATGATTAACTAAATTGT