Microarray Probes on PGSC0003DMT400012539

Probe IDChipProbe Sequence
CUST_33855_PI426222305 JHI_St_60k_v1 GTCGACCCCCAATATGGAAAATGCTTTATTAATTGATTATCTTCTCTCTTTTGGGAATGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400012539

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400012539 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14090.1 +1 0.0 798 424/627 (68%) exocyst subunit exo70 family protein D3 | chr3:4669508-4671379 REVERSE LENGTH=623

Transcript Sequence (3433 bp)

>PGSC0003DMT400012539 3433 pgsc_dm_v3.4
CTTTAATTTCTCAAAAAGAAGAAGAAAAAAAAAAAAACTCTCAAATTCACCTTCGCCTCC
ATTTTTAAATTTCTCATTATCATTCATTCATTTCGATTCTCTAAGCTCACAAATTATTTT
CGAGATTCCGAAATTTCAAAGGTTAAAATGGAGCCACCGGGAAACGACGTCGTTGCGTTT
GAGTCAGCTGAGAAGATAATACTCCGGTGGGATTCCACGGCGTCGGAAGATGCTAGAGAG
AAGATGATCTTCGCCGGAGATCGATATGAGATCGAGCGGTACTTGCAAGCTGTTGATGAA
ATCCAACGGTCCATGGAGTTTGCTACACTTTCCGATGACCAGAACAAAGCTAATAGTGCG
ATCCAGATCGCTATGGCTCGGCTTGAAGATGAGTTTCGGAATATACTCATAGCTCATACG
ACTCCTATGGAAGCTGAATCTCTTACTGACAGTAGTCCTCTGCCTGAAGAAGACTACGAG
GATGACTCGCCGTTGACCAAGGACTTGGAGCATCAAGAGAGTAACAGCACCTGTAGTTAT
CGATCTACAAATAGCATTCGTGAAATCGATCTAATGCCTTCTGATGCAATTTACGATCTC
CGATGCATCGCTGAGCGAATGATTTTGGCCGGATATCTTCGGGAGTGTATTCAGGTGTAT
GGCAGTGTACGGAAGTCTGCAGTGGACTCGAGTTTCCGCAAGCTTGGGATAGAGAAGCTG
AGCATTGGAGATATCCAGAGATTAGAATGGGAAATTCTAGAAACGAAGATCCGGCGGTGG
ATACGAGCTGCAAAAGTATGCGTTCGGATACTTTTCGCTAGTGAGAAGAAACTCTGTGAG
CAAATCTTCGAAGGTTTAGGTACTGCCACGGACGATGCTTGTTTCATGGAGACTATTAAA
GGTCCAGCTATTCAGCTATTCAATTTTGCTGAAGCCATTAGCATTAGTCGGAGATCACCG
GAGAAGTTGTTTAAGATATTGGATCTTCATGATGCTTTATCGGATTTACTAGTGGACATT
GAGATTGTTTTCGATTCAAAATCTTCGGAGTCAATTAGGGTTCAAGCTGTAGAGATACTA
TCTAGGTTAGCGGAGGCTGCAAGAGGGATATTATCTGAATTTGAAAATGCAGTGCTTCGA
GAACCTTCCAAGGTTCCTGTACCTGGAGGGACAATTCATCCCTTGACTAGGTATGTTATG
AACTACATAAGTTTAATCTCAGACTACAAACAGACCATGTCTGAATTGATTGTCTCAAAG
CCATCAACAGGGTCAAGGTATTCGAGTGATCCTAACACTCCTGATATGGATTTTGCGGAG
TTAGAATCACATACCCCGTTGGCGCTGCATTTGATCTGGATTGCTGTAATTTTGCAGTTC
AATTTGGAAGGTAAGTCTAAGTGCTATAGGGATACTTCATTGACACATATATTTATGATG
AACAATGTACATTATATTGTCCAGAAGATTAAAGGGTCACCTGAGCTAAGGGAGATGGTA
GGGGATGATTGTTTAAGGAAATTAACAGGGAAATTTAGGCAAGCAGCTACCAACTACCAG
AGATCAACCTGGGTGAATGTTTTGCATTGCTTGCGAGATGAGGGTTTACATGTTAAAGGC
AGTTTTTCATCTGGGGTGTCTAAGAGTGCGTTGAGAGAGCGGTTTAAGACCTTCAATGCT
ATGTTTGAAGAGGTACATAGGACTCAGTCCACCTGGTTGATACCGGATACCCAGCTCCGA
GAGGAGCTGCGTATTTCTGTATCTGAGAAGTTGATCCCAGCTTATAGATCATTTCTCGGA
AGGTTCAGGAGTCATATTGAGAGTGGGAGGCATCCGGAAAACTATATCAAGTATTCCGGT
GAGGACATTGAGACTGCTGTCTTGGATTTCTTCGAGGGGTACCAAGTTTCACAACACATA
AGAAGAAGATCTGAATGAAAGGATATAAATTCCACTAATTAGAACCTTAGGACATTCTTT
GAATTTTTTTCTGGAGTCATTTAGGAGGAGCTGAGGTTCTGGAGTTAAGGTATTGTCGGG
CAAAGCAGAAAAAGATCAGCTGTATCTATGATAGTCTCCGCCTCTGCCTAAATGCTCCTG
CCCTGTAAGCGCGGTGTTGTTGTATTTCTTCCATATGTTAGATTTTATTTCATTTTGTCC
ATATCTGAATTGGTGCATTTGGTTTTTACTCAGAAATTTTTGAGCCATCAAGATCACGAG
TACAGAGTTTCGTTTATCCTTGCAGGTCACCCTCTAAGCCCATGCATCTTATCAGGTGCT
TAATATAATCTGAACATTGAAGGCAACATTTCTAAGGTCAATATCCCTAACAACTGATTA
CTTATTATCAAACTTGATTTCAAAATTCCATTAACAATATCATAGTTTATGGTATTCCCT
TGCTTCTTCTGAGCCGAGGGTAAGGTTTGCGTACATCCTACCCTCCTTAGACCCCACTTG
TGGGATTACAGTAGGTATATCGTTGTTGTTGCATAGTATTTCCCTTGATTTATTCTTACT
GCTTACAAGTTAAGGTCTTTATCAGTGAAATGAAAACAGTTCTTGATGATTTTCCAACTA
TAACACTGGAAGTTGTTGCAGTATGACAATTTGCTGATGTATTTGGTAAAGCACCATACA
AAACTATTGGAGCTTTTTGCTTAGCTGTGACTTGTGCCCTTTTACTGATAGGGACATAGG
GTAAGTAGTGCTTGTACTTTACAAAAAACAATAAAAGAAGGATAAGTGGTGCTTATTAGC
TGTTGTTGGAGATCAAGAGAACATTACCAATCACTTTAATTGTTTAATACTCTCAAACAT
GAATGCTTACCTTATCTCATAAAAAGAAGAATAATTGAAACTCTTATAATTTGCTACAGT
TAGAACACAATATAAGTGGATACTTCCTGCTTGCTTTTACTTGAGCATTGTGTTAATTTG
CTCTCTGTAGTGCTTCAGATTGTTAGTTTACCCTTTGTAAGTATATCATTTGCAGTTGCA
ATCTTTCCACATATCTTCATTTTACATCGTATTCATCGTGTCTCTGTAACGTGCCCTATA
CACAGGAGTTCAAGCTAGTCTTTCCTAACATGATTTTTTTTCGAATTCTGCTTCCGTTCA
TTTGAAAGGTCAAATAAGGGTGACACTTCGATTCATCAATATTCAATTTTCAATGGTCTA
AGTTTGTCTTCAGCCGCCAATTACAAGAGATGTAATGGTCCACGAAGATTCAAATGTATT
CTGGGGAACAAGTCAGAATGAGTAACATAGAATTTTCCCCTAGCTTGTTGTAGGTTTGGT
GAATAAACAAACAAACACTTCATGAGATGGTATAGAGTATAGAGAACTTGGTTTGTCGAC
CCCCAATATGGAAAATGCTTTATTAATTGATTATCTTCTCTCTTTTGGGAATGTTACTTC
GCCACGTTATAAT