Microarray Probes on PGSC0003DMT400012414

Probe IDChipProbe Sequence
CUST_33872_PI426222305 JHI_St_60k_v1 GCTGCTCCAGAGTACATCATGACTGGTAATTTTTTACATTATCAGTGTATTTTAACCTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400012414

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400012414 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G05940.1 +2 8e-134 258 135/224 (60%) Protein kinase superfamily protein | chr2:2287514-2289270 REVERSE LENGTH=462

Transcript Sequence (1923 bp)

>PGSC0003DMT400012414 1923 pgsc_dm_v3.4
GAACAAATTAAACCGTCACTTTAGACTTGTTACAAACTCTTTTTCCCTGTTTGGTTTCAT
TAACACATTTTGTCAAACACCTTGTGAGCAGTAAAAATTGACACCAAACTGATCAAATTT
CATCAGATTTAGTAGAACAGCTATGGTTACTTGTGGAATTGACTGGAAATCTGTTCTGCC
TAATTGTTTTAAGGGCAATAATGTTCGTTCGGAGGCGAAGGTGATGGAGAACAGTAAACA
GATGAATTCTGATCATCATAGGTTAGCTTTTTCAGATATAAGTACTGATTCTAGATCAGT
ACTTATATCGTTGGATGATCTCTCATCGAACGCGGTTATTGGTTCAAATCTTCATGTATT
CACATATGAGGAGCTTAAACTCATCACTAGTGATTTCTCCCCTGCTAATTTTCTCGGTAA
AGGTGGATTTGGACCCGTTCACAAGGGGTTCATTGATGATAAGATTAAGCCTGGTTTGGA
TGCTCAACCTGTTGCTGTTAAATTGCTTGATTTGGATGGAAATCAGGGCCATCAAGAATG
GCTGACTGAAGTGGTCTTTTTGGGGCAATTGAGGCATCACCATCTAGTGAAGTTGATTGG
ATATTGTTGGGAGGAGGAGCAGAGACTTCTCGTTTACGAGTATATGGCAAGGGGAAACCT
TGAGGATCAACTATTTTCGAGATATTCGAGTTGTTTGCCATGGTTGACCAGAATAAAAAT
TATGGTTGGTGCTGCAAAGGGACTGGCTTTTCTTCACGGAGAAGAAAAGCCAGTAATCTA
CCGTGATTTTAAGGCTTCTAACATCCTCTTAGACTCGGTAAGTTGTCTATGAAGTATTGT
TTTGACATTGAAAAGTTCAACTCTTTTTTCATGATGAAGTCAAAGCTAGAAACTTATAAT
GCTATGAATTATCAGGATTACAGGGCCAAACTATCTGATTTCGGGCTAGCAAAGGATGGA
CCAGAAGGCGATGACACACATGTCTCGACTCGTGTGATGGGCACTCATGGCTACGCTGCT
CCAGAGTACATCATGACTGGTAATTTTTTACATTATCAGTGTATTTTAACCTGTTGTAAC
ATGTTATATGTCTCATTTATCGTGTTACCACTTATTACGAATACTTAAAACTTTCATTTT
CTTTAAACAGGTCATTTGACAAGCAAGAGCGATGTGTACAGCTTCGGAGTAGTTTTGTTA
GAACTAATAACAGGACGACAAGCCATGGACAAGAAACGCCCCCTCAAAGAGCGAATCCTG
GTGGATTGGGCAAGACCAATGTTAAGGGATCCACACAAACTTGACAGAATAATGGACCCA
CGACTTGAAGGTCAGTACTCGACACAAGGAGCAAAGAAGGTTGCTGCATTGGCTTATCAA
TGCTTAAGCCACCAGCCAAGGTCTAGGCCCACTATGAGCAACATAGTGAAGATCTTGGAG
CCAGTCTTGGACATGAAGGATATACCAATGGGCCCATTTGTTTACGTCGTCCCCTCCTCA
AAACCTGACAAGGGAACGGAAATTGGTGAATTGAAGAGTAAAGTGGACGATGAAAACAAG
GCGAATGTAAGGGAAAAAGAAGTAGGAAATGCAGGGGAAAACAGAGAGGATGGTAATGCT
AAGCAACGGAGAGCCGGACACAGGCATAAACACAGGCTAAAGACTGATGCTTCTGTTTAC
TCAGATACTCATTTGTATCAAAAGACTGTAAGGCACGAAAGAACAAACAAATTAAATTCT
TGTTGATTAATCGCAATGAAGAGAAGAAAGGGAAAATAGATTAAAAATGTAAAACATATG
TGAATAGATTGTATAATGAAGTACTCCAAATGTATTTTTTTGTTAAATTAGTTTACATTT
TAGTCTCAGTTTTGGACAAGATCCTTTTAGTGTTTTCGTTTTGGTTGTTGAAAGCAATGT
ACA