Microarray Probes on PGSC0003DMT400011522

Probe IDChipProbe Sequence
CUST_19758_PI426222305 JHI_St_60k_v1 TGGGTGTACTTGTTTGTTGTTCATTCGACAGAATTTGGCTTGGTAAAAAAGGCTCGTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400011522

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400011522 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10960.1 +2 2e-42 143 86/143 (60%) ferredoxin 1 | chr1:3664445-3664891 FORWARD LENGTH=148

Transcript Sequence (651 bp)

>PGSC0003DMT400011522 651 pgsc_dm_v3.4
TTTAAATGCTCATTAGTGAAGTGAGATCCAGCCAAGCACAAGAAAGATAAAAATGGCCAG
TATTTCAGGCACCATGATCAGTACCTCCTTCATGCCAAGAAAACCAATTGTGACATTTCC
AGATCTCCTTGGGGTTAAATATGCAAATGGTGGCAAAATAACTTGTATGGCTACATACAA
AGTGAAACTTATTACACCTTCAGGAGCAGTAGAATTTGATTGTCCAGATGATGTGTACAT
TCTTGATCAAGCTGAGGAAGAAGGACATGAACTTCCTTATTCATGCAGGGCAGGTTCTTG
CTCATCTTGTGCTGGTAAAATTGTATCTGGAAGTGTTGATCAATCTGATGGAAACTTTCT
TGAAGATGAACAAATAAGTAGTGGATATGTGTTAACTTGTGTTGCCTATCCACAGTCTGA
TGTTACCATTGAAACTCACAAAGAGGAACAACTCACAAGCTAAACTAAATTTGGAGAAAT
TTTATGTTTATAATGTGGCCAAGTTTATAGTATATGTGAGTGTATTTTTCTTTCATTATA
ATGTGAGTGTAATTGGCTGCTTTGTAATATTGTTATTCTGGGTGTACTTGTTTGTTGTTC
ATTCGACAGAATTTGGCTTGGTAAAAAAGGCTCGTTTTTATTAAATGTTCC