Microarray Probes on PGSC0003DMT400011188

Probe IDChipProbe Sequence
CUST_51361_PI426222305 JHI_St_60k_v1 GCACATGATCTTTAGTGCTTGTTTGGTTAATGTTGTACCAAGTCAAATTAAAAGTCCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400011188

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400011188 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G49340.1 +2 4e-113 338 164/339 (48%) Cysteine proteinases superfamily protein | chr3:18293347-18294577 REVERSE LENGTH=341

Transcript Sequence (1181 bp)

>PGSC0003DMT400011188 1181 pgsc_dm_v3.4
AAAAAAATCAATTATTTTACCTAGGTATTTTCTTGTAATTATGGCTTTGGTTCTTGCATG
GAAAACACAATTCACCCTTCTCTTTGTGATTTTTGGGATGTATGCATCTCAAGTCACTTG
TAGAAACCTTCAAGATCCATCCTCCATGTTGGAAAAACACGAGTCATGGATGGCGCGACA
TGGAAGAGCTTACGAAAATGATATAGAAAAGGCGAAAAGATTGAATATTTTCAAGAAGAA
CGTCAAATTTATTGAGTCATTCAACAATAATGGTAGTAGGTCATATAAATTAGGCATCAA
TAAATTTTCTGATCTTACTTCTGAGGAATTCTTGAGGTATTATACTACTAATCATGGACT
TAATAATAAGTTTTCTTCTATAAAATCTCAAAAATTATCTCCAACAACAATTTCATCATT
CAAGTATGAAAATACGAGTGATGTTCCATCTGAAATGGATTGGAGAAAGAGTGGTGTTGT
CACTAGCATCAAAGATCAAGGAAGATGTGGATGTTGTTGGGCATTTTCCGCGATCGCGGC
CTTAGAAGGAGCAAATAAACTCTCAAAGGGAAAATTAATTTCACTCTCCGAGCAACAACT
ACTAGATTGTTCAACCGAAAACTACGGTTGTAACGGCGGATTAATAACCACGGCCTACGA
TTACATCGTAAAAAATAATGGTATCGCCGCTGAATCCGACTACCCTTACGAAGAAAATCA
AGATTCATGCAAAATACAAGACTCGATAGTAAAAATGAGTAACTACGAAACGTTACCTCC
ATCAAGTGAACCAACGTTACTTACCGCGGTGGCGCGACAACCCGTATCGGTGGGTATCGC
GGTGAATGAAGAGTTTATGTCATACCAAAGAGGAGTTTATGATGGAAATTGTGGTGATGA
AGTAAATCATGCAGTTACAATAATTGGTTATGGTACAAATAATGAAAATGGTGCAAAATA
TTGGATAATTAAGAATTCATGGGGGTCTAGTTGGGGTGAAAATGGTTATATGAAAATTGC
TAGAGATATTGGAAATAATGACGGTCTTTGTAGGATAGCTACTATGGCTTCATATCCTAT
TGTTTAGAAAATTTGGTTTAAATTAATAGCACATGATCTTTAGTGCTTGTTTGGTTAATG
TTGTACCAAGTCAAATTAAAAGTCCTTGTATTACATAATTG