Microarray Probes on PGSC0003DMT400011069

Probe IDChipProbe Sequence
CUST_50027_PI426222305 JHI_St_60k_v1 TTCTTCATGTCCAAGTAGTCTACTACAACATCAACAACCTACTAACCCACATCTTTAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400011069

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400011069 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G13180.1 +2 5e-71 223 116/228 (51%) NAC domain containing protein 83 | chr5:4196643-4197577 FORWARD LENGTH=252

Transcript Sequence (915 bp)

>PGSC0003DMT400011069 915 pgsc_dm_v3.4
GAAAGTCTCTCGATTCGTTCTCTCATAAATAAATAAAGCTTGTGTTGATAGAGTCGAATA
ATTTAATTAATTGATGGACAAGTTCAATTTTGTGAAAGATGGAGCGATAAAGCTACCTCC
TGGTTTTCGATTTCAACCTACTGATGAAGAAATTGTGTTTCAATACTTGATACGTAAAAC
ATTTTCTTGTCCCTTGCCTGCTTCTATTATCCCTGAAATCAATATTTGCAGTAACGACCC
CTGGGATTTGCCTGGTGACATAGAGCAAGATAGATATTTTTTCAGCAACAAGGAAGCTAA
ATATAGGAATGGTAATAGAGCAAACAGGGCAACTATAGGTGGCTATTGGAAGCCAACTGG
TTTAGATAAACAAATTATATGCAGTAAAAGAAAGCCAATTATTGGGATGAAGAAAACTCT
TGTTTTCTATAAAGGAAAGACTGCTTCTCAAGCTTATAGAACTGATTGGATTATGCATGA
ATATCGTCTTGTTCTTCCCAAAAATTCATCATCCAATTTACATGCCCATTTCAAGAAATC
TTCTCAGAATTCATTGGTTCAAATAGGAAATTGGGTTCTTTGTCATATATTTTTGAAGAA
GAGAAATGGAAAATGTGATGAAGAAATTGTTGAGGCTAATTATCATGATGATAATTACAA
GACTAATTATGATGAACATAATATAGTCCAACCAATAGTGTATTATGATTTTATGAGGGA
AGATAATTTGAGTGATAGTAGAGGTGCAGCTTCCTCTTGTTCTTCTTCTTTGAGCATTAA
TGATGATGCAAATGAGGTTTCTTCATGTCCAAGTAGTCTACTACAACATCAACAACCTAC
TAACCCACATCTTTAATTCATAATATTGTACGTTTCTTGTTTTCCCATTGTTTAATGCAA
TAATATTTTCTTCTA