Microarray Probes on PGSC0003DMT400010684

Probe IDChipProbe Sequence
CUST_11355_PI426222305 JHI_St_60k_v1 TGTTGCTAATGGGAATTTGGACACCCCGATCATCAATAATGTGCCAAAGATGGTAGGCGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010684

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010684 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47340.1 +1 0.0 859 423/512 (83%) glutamine-dependent asparagine synthase 1 | chr3:17438136-17441043 REVERSE LENGTH=584

Transcript Sequence (1572 bp)

>PGSC0003DMT400010684 1572 pgsc_dm_v3.4
ATGTTGTCGACTTGTCGTGTTAATGGAGAGATCTACAATCATGAAAAACTTCGAAAACTT
ATGCCTAATCACAAGTTTAGGACTGGAAGTGATTGTGATGTTATTGCTCATCTTTATGAA
GAATATGGAGAAAATTTTGTTGACATGCTGGATGGAGTGTTCTCTTTTGTATTATTGGAT
ACTCGCGATAATAGCTTTCTTGCTGCTCGTGATGCCATCGGAATTACACCCCTCTATATT
GGTTGGGGACTTGATGGCTCTGTGTGGATATCATCTGAGCTGAAGGGCTTGAATGATGAT
TGTGAACATTTTGAAGTTTTCCCTCCGGGGCACTTGTACTCTAGCAAGAACGGAGGGCTT
AGGAGATGGTACAATCCCGCTTGGTTCTCTGAAGCAATTCCTTCCACTCCTTATGACACT
TTGGTTCTGAGGCGTGCCTTCGAAAATGCTGTTATCAAACGGTTGATGACTGATGTCCCC
TTTGGCGTTCTGCTCTCGGGGGGACTTGATTCGTCTTTGGTTGCTTCTGTCACTACTCGA
TACTTGGCTGGAACAAAAGCTGCTAAGCAATGGGGAGCACAACTTCATTCCTTCTGTGTT
GGTCTCGAGGGCTCACCAGATCTCAAGGCTGCAAAAGAAGTTGCTGACTTTTTAGGAACC
GTTCACCATGAGTTTCACTTTACTGTTCAGGACGGTATTGATGCTATTGAAGATGTTATA
TATCATATCGAGACGTATGATGTAACAACAATAAGAGCCAGCACTCCTATGTTCCTTATG
TCGCGTAAGATTAAATCACTAGGAGTGAAGATGGTCATATCAGGGGAAGGCGCTGACGAA
ATTTTTGGTGGTTACTTGTACTTCCACAAGGCTCCCAACAAGGAAGAGTTCCACACGGAA
ACATGTCGCAAGATAAAAGCGCTTCACCAGTATGACTGTTTAAGAGCAAACAAGGCTACA
TCCGCGTGGGGCTTAGAAGCTAGAGTACCATTTCTGGATAAAGAGTTCATCGATGTTGCC
ATGAGTATCGATCCCGAATGGAAGATGATTAAGCATGATCAAGGAAGGATTGAGAAGTGG
GTTCTTAGGAAGGCGTTTGATGATGAGGAGCAACCGTACCTTCCAAAGCATATTCTGTAC
AGACAGAAAGAACAATTCAGCGATGGCGTAGGCTATAGTTGGATCGATGGCCTCAAAGCA
CATGCTGAACAACATGTGACTGATAGGATGATGCTTAATGCTGCTCATATCTTCCCACAT
AACACTCCGACTACAAAGGAAGGATACTATTACAGAATGATTTTCGAGAGGTTCTTCCCA
CAGAACTCAGCAAGCCTGACCGTTCCTGGAGGACCGAGTATAGCTTGCAGCACGGCAAAA
GCAATTGAGTGGGATGCTTCTTGGTCGAACAACCTTGATCCTTCCGGTAGGGCTGCTATC
GGTGTACATAACTCTGCTTATGACAATCATCTATCTAGTGTTGCTAATGGGAATTTGGAC
ACCCCGATCATCAATAATGTGCCAAAGATGGTAGGCGTGGGCGTGGCTGCAGAGCTCACA
ATAAGGAGCTAA