Microarray Probes on PGSC0003DMT400010633

Probe IDChipProbe Sequence
CUST_11409_PI426222305 JHI_St_60k_v1 CACTATCAAGGTCACTATCGAACTTCAATTCATTAATCGAGTTTTGAAAAAGTGGTCAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010633

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010633 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07300.1 +2 2e-09 56 27/73 (37%) josephin protein-related | chr1:2245914-2246300 REVERSE LENGTH=128

Transcript Sequence (1343 bp)

>PGSC0003DMT400010633 1343 pgsc_dm_v3.4
ATTTCTAGCAAGTCTTCCAATTATCACCTCCCCCTCTTTAAAAATACTATATGATTGGTG
TTCGAGTTAATTTGCGTAAAATCATTTTTTATTTTTACTATTTGTTCTCCATATAAGCAC
ACACACCATCTTCACCTTCTTTCCTCATTCCAATTTCTAGTAATAAACTTTCAAGGTAGC
ACTTCCCTCATCACCACATATACTAAATTAGTATATTTTAAAGAAATTATATAACGATAA
GTGGTTAAGTCAGTATGCGTTAAATTATCCTTGATTTCTACCCTTTCTTTTCTATATAAG
CACAAAATATGTACCTTCTCTTTCTTCATTCCAATATCTAATAGTCTTCCAATTATCACT
TCCCCTTACCATCTATACTACGTTTTTATTTTTTACATTAACTAACGATAGCGTTGAAGG
TGGTTTCCGTTAAATTATCTTTGATTTCTATTTCCAGTACCCTTTGTTCTCTATATAAGC
ACAAATCATGTTCACCCTCTCGCTTCATTCCATTTTCTAGTAATCTTCCAAGGAATCACT
TTTCTCACTACCTATACTAAAGTTAGTATATTTAAAATATATATATAACTGTAGTGTTCA
AGTCAATTTGCATTAAATCATCTTTGATTTCGAGATGCCGGTAAGAGGCTGTGAAGGAGG
GAGTGTGGTGAAGCAAGAGATGACCAAGAATACAAAGATAGCAAGCAAGTTTCAAAAGCA
AAACTCTACAAAGAGTGTTGTTGATGGTACTACAAATGATGCAAGAAGTACCACCACCAC
AACAAGTTGTAGCTTCAAGATGCCTAATAGATCCCAATTATCCCCTATTAAGATTTTCAA
ACATCTTGGAGGAAAAATGGCTGCACTTATAAAGATGGTATCTTCTTCAAAGAGAAGTTG
TAGGAAAGTTACTAATTCTCCAGAGAGAACAACAATTTCTGCTAAGCCAACCGCTGCCCT
AAATATTGACTCACATAGGGCAGAGGCCATTGATGATTGTATTCAATTCATCAACTTGTC
TTCTTCTTTGCCTAGATCTAATTCAGTGTCATAAGAGATCGGAGAATCTCTTGATAAGGA
GCGTTTTATCGTGTTATTTATATTAATTGACCATTTTTTGTGGTTTTGTATCTATAAGTT
GGTTATATTTTTAAAATTAGACGTGTGATTTGAATACAATAATTAATTTTGAATGACTTT
CTAGTCAATAGCCACTATCAAGGTCACTATCGAACTTCAATTCATTAATCGAGTTTTGAA
AAAGTGGTCAACTTTCAAATAGAACATCAAGAAGTGACTATTTGTGTAAATTAGCCCTAA
ATACCCTTTTAATCGAATTTTAC