Microarray Probes on PGSC0003DMT400010545

Probe IDChipProbe Sequence
CUST_31017_PI426222305 JHI_St_60k_v1 ATATCTCAAACATTTGACGTGTATTTTGCTTTCCTTAGGGAATATTTGGCTCAGCATTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010545

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010545 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G28050.1 +1 6e-15 73 44/78 (56%) nodulin MtN21 /EamA-like transporter family protein | chr3:10442984-10445216 FORWARD LENGTH=367

Transcript Sequence (676 bp)

>PGSC0003DMT400010545 676 pgsc_dm_v3.4
CAAATGTCAATAGAGAACACTGAATGTGTTTTTTTATATTTGCTCAGCATTGAGGGGTAT
ATCAGTTGCATTCTTCAGCATATCTCAAACATTTGACGTGTATTTTGCTTTCCTTAGGGA
ATATTTGGCTCAGCATTTCAAGTCAGTGTGATGTTTTGGTGCATTCGTAGAAAGGGACCC
CTCTTTGTTGCTATGTTCCATCCTCTTGGAATCGTAATTGCTGCTGCATTGGGTATAATC
TTCTTAGGAGATATTTTCTACCTTGGAAGCTTGATGGGGTCAATTATAATTGTTGTTGGC
TTTTACGCTGTTATGTGGGGAAAAACAAAAGAAGACAAGGTGGATGAAGACAAGCTCACA
AGAAATATCAATTCAAAGTCCCCACTCTTGGAAATAAAGGATGCAGAGACAAAAATTTAA
GCATAAATTATAGAATGGAAGAAGTCAAAGCAAGTTGACAATGCATATTGTGGAAGTTGT
AGACATGGAAGCCACAACCAAATGGAGATCCTCCTTTACTAAAGTTTGTATAAAATAGTT
TGAAACATTCATACACGTGCTCAACATTGTTGTAAATGCAGAGCACATAAGCCTATGAAA
TATAAAATAAGTCTCTAATGACTTGGTTTGTCACTCATTTTATCAGTGTGTATATATATA
TACTATTATTATTCTG