Microarray Probes on PGSC0003DMT400010394

Probe IDChipProbe Sequence
CUST_28740_PI426222305 JHI_St_60k_v1 GCTTCCATTTATTTCATCTGAAGTGTCTTGTAGAGTTGCTTTTTATATATGGCCTATCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010394

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010394 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G08130.5 +2 2e-56 204 153/310 (49%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr5:2606655-2609571 REVERSE LENGTH=532

Transcript Sequence (2926 bp)

>PGSC0003DMT400010394 2926 pgsc_dm_v3.4
TGAGACCCATTTTCTCTTACTCTTTTTTTTTTTTTTTTTTCCATATTTAAGGAAGCAACC
AATCGAGGCTGGTGTTTGTTCATCGTTTGCGTTAATCAAGACGAGGCCCTACCATTAATC
CTTCAAAAAATTCACTGTTTCGATCAACTTATCATTACACAGTTCTGTTTTCATTTTTTA
CAACGAAATCTAAGGAGAATTATGCATTTTACACCACCAAATCATATTACAAATTTGGTG
GAATAAACCTGCATCATCCCTGTTTTTTCAAAGAGGATTGTTATTAACAATTTTATTAGT
TTGAGACTGAGACGTACTTAGTTGAAAAAAGGACGGTTTCTGATGTGACTCAAATCCTCT
GTTGGAGGCAGATCTGCTTGGAACTAGAAGAGGTTTGGGTTTGAAGTTGTTGAATTACGC
AACAACTTTTCGAAATTCAGTTGAATTGTGCTGCATTTTAGTCGCTTTTGTTTATTCGAA
ACACAGAATTCTGATTTGAATGGAGTTACCTCAATCCAGGCCTTTTGGAACAGAAGGGAG
GAAGACTACGCATGATTTTCTTTCACTATATTCACCTATTGAACAAGATCCAAGACCTCC
ACAAGGTGGCCACCTAAAAACTCATGATTTCTTTCAACCTCTAGAACAAGCAAGGAAGAC
AGTTGGGAAAGAAGAAAATAAAATTGAGGTAGAGGCTATAGAAAAGCCGCCTCCATCAGG
AGAACATATTCTTCCTGGTGGCATTGGCACATATAGCATTTCTTATTCACAGCAAAGGGT
TCCAAAGCCAGAAGCAAACACATTTGCTGTCACACAAACTAGCAGTACAGATAGAGACGA
TAGAAACTCAAACTGCAGTTCTTACTCGGGAAGTGGTTTGGCACTATGGAATGAATCTGC
CATGAAAAAGGGAAAGACTGGGAAGGATAATCTCGCTGGAGATAGACATGTCGTAAGAGA
AGCAGGTTTAAACATTGGAGGAGGGAAACCTACGACATCATTAGAACGGCAATCACAATT
GTCTTCAAATCATAATCATAACACTGCAACCTTGAGCTCACACTCATCTCCTCAGCAACC
ATCAGCTATGGAGAATCAGAGTTTCATACATATGATAACATCGGCAAAGAATGCACAGGA
AGATGACGATGACGAAGAAGAAGAATTTGTTGTTAAGAAAGAGTCACCTTCACCATCCAG
AGGCAATTTATCAGTAAAAGTCGATGGGAAAAGCACTGATCAGAAGCCAAATACTCCACG
CTCGAAGCACTCAGCAACAGAGCAAAGAAGAAGAAGCAAGATCAATGACAGGCATGTTTA
CAACCCTAATTTAGAGTTTTGAGAAAAGAAAAGGAAAAGTTTTTGGCATAGTGACTATAT
TTTGTGGGAAGGGGAATGTTAGTATGATCTGACTTCCAAGCATTGATGCATTGACTAGCA
CACTCTTCACTCAGTTTTTTCTAGCCTCTTACTTGAGGCAGAAGCTATCTCTGTCTAGAT
ATCATGTGTTAGTTGGAACATTTTAATTCCTTTGCTGAACAATTACTAGTCTTGGTTCTG
TCAATCTTTTACTGTGTAACCGGACTTATGAACAGTCGAATAACATGACTGTCAATGAAA
ATTGAACCATTACCTTTGGAACTTTTTAATCAGATTTCTGAAGTTGAGAGAGATCATCCC
TCACAGTGACCAGAAGAGAGATAAAGCATCATTCTTGCTGGAGGTTATTGAATATATTCA
ATTCCTACAAGAGAAAGTGGACAAATATGAGGGATCCTATCAAGGTTTGGAGAATCAACC
TTCAACATTACCTTGGAATAAGTGTCATAGTATGGCTCAAGGTTTCATTGATCATTCTCA
AGGCACAAACAGTGCGTCTAGTCATGCACTTATTGCTGCAAAGTTTGACGAGAACAAAAC
TGGAATCTCTGCTACAGGGCCTGTCAATGAACAGACACTGGAGCCAAACAGAACTTCCAG
TGTGAAAGAAAGCAGTTTTCTGTCTGAATTAACAAACAGGGCCGCAACACTTTGTATGCA
ACCAAACACATTCCCATTTGATGGAAATATTAGCATAGCATCGCTGCAGTCAATAGTGGC
GCCTGATACTGGCTCGTTGGAATTGAAATCTCAGCCTCAATTTCCATCAAGCAGATCGAA
TATGACTAATTATGCTGTTACAAATGACAAGCTAAAAGGGCAAGAGGTTTCTACAGAAAG
TGGTACAATCAGCGTCTCCAGTGTCTATTCTCAAAGGTTGATGAACACACTGAAACAAGC
ATTGCAGAGTTCTGGAGTAGATTTGTCACAAGCCAACATGTCAGTGCAAATTGATCTCGC
GAAAATAGCCAATGATAGATCAAATGCTTCAACGTCCAATTTTAAGGGTGACAACATTTC
CTCAAGAAATCAACCAACTCCACAATTCATTGATACAAGCACAAGAGAGGAGTCTGTCCA
TGCCTTCAAACGGCTCAAAACAAGTTAAAAGCAAATTTAACACACAAGTATTCTTTTGCA
ATTGATTCAACTAAAAAAATTCCTTTCCCTTCTGGTTCTGAAGGGATATTCATGTATACA
TCTGGTATAGAAAATCTCCCCTAATCAGATCATAAGCTACTGTAAATGTAATTCATTTTC
TTTTCCTTTTCGATTGTTTGGCTGCACAGAATTCTTCTGACTAAAGTTCGATATTTATTA
CTTGTAGTGAACTATCAAGAAATCATATATCAATATTGAGGCTTCCATGCTCATGTTGAG
AAGCCGCCTTTTAATATAAGGCTTCCATTTATTTCATCTGAAGTGTCTTGTAGAGTTGCT
TTTTATATATGGCCTATCCATGTAATGTAAAGTATTTAGATTAGTGTAATCATTTATTTT
TTTTCGTTTTATCTTTTATTTTTGTAGCTATTGACTTGCACCAGAG