Microarray Probes on PGSC0003DMT400010229

Probe IDChipProbe Sequence
CUST_3623_PI426222305 JHI_St_60k_v1 CACCGCAATTCGGCTCATCCAATTATCAAGTGAATATCCTCTTTAATAATGTACTCTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010229

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400010229 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36920.1 +1 2e-107 338 223/332 (67%) Integrase-type DNA-binding superfamily protein | chr4:17400998-17403140 FORWARD LENGTH=432

Transcript Sequence (2303 bp)

>PGSC0003DMT400010229 2303 pgsc_dm_v3.4
AAAGAAAAGAATACAACTAGAGGGAGGGATAGAGAGAGAAATAGAGGAGAATATTTAAAA
GTCTAGGAAACTGAAAACAAGTCCTTTTGTAGCAATAGCCAAAACCACCCACCTCACACA
TAAAAAAAAAAATCTGAAATTTTTTCAACTGTTTTCTTTTTTATAATTTTGAGATTTTGG
ATTGGGTATTTTTTGTAGAGAGAAATGTGGGATCTAAATGAATCAGAAGAAGGTTGTTCT
ACTCCGATAGAGTTTGAATGCGATGATGAGAAAGGTAAACGGGTCGGATCCGTTTCGAAT
TCAAGTTCATCGGCTGTAGCTGTTGATGATATTTCTGAAGAGGAATTAGATGGAGAAAGA
GGGAAGAAAAAGAGAGGTACTCCTCCAAGCAAAATTTTCGGGTTCTCTATGGTGGGTCCG
GGTAACGGCGATGAAGAACAGCCGGTGACCCGCCAGTTTTTTCCGGTTGATGAGTCTGAA
ATGGGTGGTGTTGCTGCTGCTGAAAATGGATCCCCGAATTTTCCCAGAGCTCACTGGGTT
GGAGTTAAATTTTACCAAACGGAGACACTTGGCAACACGGGATTGGCGAAGCCTGTAGAT
ATGGTTCAGCAGCAACAGCAGCAGCCTATTAAGAAGAGCCGCCGTGGACCAAGGTCTAGA
AGCTCACAGTACCGTGGAGTTACCTTCTACCGGAGAACTGGCCGGTGGGAATCTCATATA
TGGGATTGTGGAAAACAAGTTTATCTAGGTGGATTTGATACTGCTCATGCAGCAGCTCGG
GCATACGATAGGGCAGCCATCAAATTCCGGGGAGTAGAAGCCGACATAAACTTTAGCTTA
GAGGATTATGAATCCGATTTAAAACAGATGACAAGTTTAACAAAGGAAGAATTTGTGCAT
GTGCTCCGAAGACAAAGCACTGGTTTTCCGAGGGGAAGCTCCAAGTATAGAGGAGTGACT
TTGCACAAATGTGGTAGATGGGAAGCTAGAATGGGACAGTTCTTAGGCAAAAAGTACGTT
TATTTGGGGCTCTTTGATACTGAGATTGAAGCTGCCAGAGCTTATGATAAAGCTGCCATC
AAGTGTAATGGCAAGGATGCAGTTACAAACTTTGATCCAAGCATTTATGAAGATGAACTA
AATTCAATTGAATCTTCCGATAACGCGGCTGATCACAATCTGGATTTAAGTTTGGGTGGT
TCAAGCTCAAAGCAAGGAAGCCGAGAATTGGGGGATAATAGAGGTCAAAATTCTTCATCA
ATGCAATTGGATATTGATTGGCAGCGCCATGGTTTAAGGCCTGAGGTATATTTACACGAT
CAATTGCTATATCTTGTTTTCGTTGTGAATTTTTTTTTCTTCTTATGCAACATGTTTTAA
TTTCCAGAAGCAATCTTCTGCCTTAATTGATGCTCGAAGAAGAGAAAACGGGTACAATGA
AACAGAAACTTTGCAACTTTTAAGCCAGACGCACTTGCATTCTCCAGTCTCCTTGAAGCA
TAATAATAGTCAAGTGCAACGGTTTAGCCAATTTATGAGACCTGGTGATCAATCCCATAT
GATTCAAATGTTTCCACCGCAATTCGGCTCATCCAATTATCAAGTGAATATCCTCTTTAA
TAATGTACTCTTTTTTTATTTTCAAATCGTGTTTTTTTTTTTTTTTAAATGTTGTGGCAT
GTTACAGATTCAATTTCCAAGTGGCAGCAATGGAGGCAGAATTGGAGGTACAAATGTAGG
AGATTTATCGCTTGCGGCGACAAGCAATGGTTCTTCACAGTGGCAATCCAATTTTCCTCC
TCAGATATTTGCAGCTGCTGCAGCATCATCAGGATTCCCTCAGCAGATAGTAAGACCTCA
AAATTGGTCCTCAGAAAATGGCTTCCATCACTCACTCAGGAGACCATCATGACTTGCTAT
ATTTCTACTTGTGTTTTTTTTAATATAATTTGTAAAGAGTAAAGGGTTGATATTCTTAAT
ACTCCATATATTACCTAATACTCTTGGTTTGAACCCAGAAAAGAAAAATTAGAAGGAAAA
AAAAAGGGTAGACAAAAAGTTTTGGAAAATATGTCTCCTCATTAGTTTGTCCAATACTAA
CTGATCGGCAAGCTTTTCAACTAGACTTGTATTACTAGTTTATTCTGACTATGAACTGCC
AATTTGGCCCATTCTCACTCATTGTAACTTGTATACATTTGGGCACTAGCTTCTCATGCA
GTATTTGAAATATAATTTATTATTCGTTTGTGTTTGCTTTTCTTGTAACAAAAGTCCAAC
TACTATGTCTTTTTGAAGTTGAA