Microarray Probes on PGSC0003DMT400009551

Probe IDChipProbe Sequence
CUST_7471_PI426222305 JHI_St_60k_v1 CTTGGCTACACAACAACAAAATTGGAAATTGCTCGTTGAATATTCAAATGATGGGTAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009551

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009551 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G28305.1 +2 1e-99 300 167/211 (79%) Putative lysine decarboxylase family protein | chr2:12081186-12084307 FORWARD LENGTH=213

Transcript Sequence (1347 bp)

>PGSC0003DMT400009551 1347 pgsc_dm_v3.4
GTAAAAATGATGAAAAAGTATAGGCGGAAAGTGTATATAAAAAAGGACCAATAATAGCAT
TTTCTTCTCACATCAACATTCCCCTCTTTGCCTCCTCTGCTTAATTCTTCAATTTCAAAG
ATAATTGCTGACTCAAACTCTCTTTTTTCTCAAAAATTCCTTCTGTTCCCCTCTCCCTTT
TTCAATCAAACTCATCGCATCGAATTTGCTTACTACGATTTACGTCACGTAAATAATGGA
AAACAATCACCAGACACAAATTCAGGCCACTAAAACATCAAGATTCAAACGCATATGTGT
TTTTTGTGGAAGCAGTCCAGGCAAAAAGCCAAGTTATCAACTTGCTGCTATTCAACTTGG
CAATCAACTGGTTGAAAGGAACATCGACTTGGTTTATGGAGGTGGCAGTGTTGGCTTGAT
GGGCCTAGTTTCTCAATCAGTTTTTAATGGTGGCCGCCACGTGTTAGGTGTGATTCCTAA
AACTCTTATGCCAAGAGAGATTACTGGAGAAAGTGTTGGAGAAGTAAGAGCAGTGTCTGG
AATGCATCAAAGAAAAGCAGAAATGGCAAGACAAGCTGATGCATTCATAGCCTTACCAGG
TGGCTATGGGACATTGGAAGAACTCCTAGAAGTCATCACTTGGGCTCAACTAGGCATTCA
TGATAAACCAGTAGGTTTACTTAATGTAGATGGGTACTATAATTCATTATTGTCATTTAT
AGACAAAGCTGTTGATGAAGGCTTTGTTACACCCTCTGCCCGTCACATCATTATTTCTGC
CCCAACTGCCCAAGAACTCATGTCTAAGCTTGAGGATTATGTCCCAAAGCATAATGGGGT
GGCACCAAAATTGAGTTGGGAAATGGAGCAACAACTTGGCTACACAACAACAAAATTGGA
AATTGCTCGTTGAATATTCAAATGATGGGTAGATTTAATATATATTTATAGAGAAAAATG
TAGTAAATTTCTTTGAAGACTTAAATTCATCGATTATGACTTAATTACCATAAGGTAAGA
TGTTGATGGGAAAAAGCTTCAGAGAATTAATTAATATAATTAGTAGCTTTACAGCAATTT
TAACTTGCTGTTTATAATTAGTTGCAAGGGGAAAAAAAATTACGTACTAATTTGTTTAGT
GTTGATTCATTTTTGTCCATTAGGCTAATCAAATGCCTAATTAAAACAGGAAAAAGTTGA
TGTAGTACAAGTAATTGTTTTTTTTTCTGTCTGTATATGATTGTTTGGTAATGTACATTA
ATTTCTTTGTTATTCTATAGTTAATTGTGTTTACTCTAATGTAAAACGTGTAAGCTTATC
TTATGAAATGAAATATAAATATATTTT