Microarray Probes on PGSC0003DMT400009514

Probe IDChipProbe Sequence
CUST_7676_PI426222305 JHI_St_60k_v1 TCTGTAAGATTGGTGATAATGATGTGTTTCCGATTTGGGATACTGAGATTGAGAGCACAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009514

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009514 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75540.1 +1 2e-63 213 154/336 (46%) salt tolerance homolog2 | chr1:28366059-28367398 FORWARD LENGTH=331

Transcript Sequence (1584 bp)

>PGSC0003DMT400009514 1584 pgsc_dm_v3.4
TTTCAACGCACCCCAGTCTTTCCCTTCTTATAAGCTCTCCATTTCTGCACTTTTCTCTAT
CATCTTCTTCTTCAATTATTTTTTCTTCTTTTTATATATAATTTAATTAATCTAATGAAG
ATCCAGTGTGATGTGTGTAACAATAATGAAGCCTCTGTTTTTTGTGTTGCTGATGAAGCT
GCTCTTTGTGATTCTTGTGATCATCGTGTTCATCATGCTAATAAACTTGCTAGCAAACAT
CAACGTTTCTCTCTTATTCAACCTTCACCTAAACAAATACCAGTTTGCGATATCTGTCAG
GAAAGAAGGGCTTTTTTGTTTTGTCAACAAGACAGAGCAATTCTATGCAGAGAGTGTGAT
GTTTCAATACACAAAGCTAATGAACATACACAGAAACATAATAGATTTCTATTAACTGGT
GTCAAAATTTCAGCGAATTCTTCGCTTTATACTTCATCAGAATCAGCATCAGCAACTTCA
TGTAGTGCGAATCAAGATTCTGTTACAAATCTCAATAAGTCTCAAACTTGCACAAAAAAG
ACTTTGCCTGTTTCTGGTTCTGTTCCTCAACAAGTGTCAGTGGCAGTTAATATTGGGGAA
AATAGTTATACAAGTAGTATATCAGAGTACTTAGAGATGTTACCTGGATGGCATGTTGAA
GAATTGCTGAATTCCTCTACAATTCCTACTAATGGTTTCTGTAAGATTGGTGATAATGAT
GTGTTTCCGATTTGGGATACTGAGATTGAGAGCACAATGAATTCATTCTCACCAGAAAAT
TTAGGTATTTGGGTCCCTCAAGCACCTCCACCTCCTACTCCTCAAAAGAATCAGAACCAA
GTTTTCCCTCAGAATATAAACTTTGGTGGACAAATTGAATTCAAGAATATGAAGGAAGTT
ACAAGTAACAAGTCAAGTAGAAAGTGGAGAGATGACAATTCTTTTGCTGTTCCACAAATC
ATCCCATCATCATCTTCTATTTCCTTCAAAAGATCAAGAACTCTTTGGTAGTTGGATCCA
ATCATCTTTTTTTCTTTTAATTCCCTAGTTTGATTTTTTTTTCTATTTCTGTGGGTATTT
CTTTATTTTTTTTTGCCTTTTCTTGATTTAGTTTGAGCAACAAAAAAAAAATGAAAAAAA
AGAACACCCCATCTCCTCTTTTGTGCTCAATTAATACACAACTTGGTTTTGTTGTGTTCT
TGGAATTATTGTTTTGGTGCAAGGGCCTCTTTTGCTTTGTAAATATCTTTTTAGGCATAA
TACATAAACACACTCTCAAATTTAGCTTAAATTGTCAAGCAAATATTTCAATTTACAAAA
TGGCCTTCTAGGACTTTCAAAATTGATGTGTTACGTCAGTGTTGGATGTCCACAAGATAC
AATAAGCAAGGATGAATATTGGAATGCTTAGTTGCTAGTCGAGACCAAATTGAGGTGTTG
AGATATGTATTCTCAAAGTTAGAAGGCTTACTTTTCAGCTGAGACTAGATTTAAGTGTTT
GTTTTATGTATTATGACAATTCCTATTATGTTTTGTTGAATCCCATAAAACTCAGAGGTT
TATGAATCAATGTTGGACACAATC