Microarray Probes on PGSC0003DMT400009450

Probe IDChipProbe Sequence
CUST_7384_PI426222305 JHI_St_60k_v1 ATACATGTACGAAGTACGTTTCCAAATGTAACCTTTCTATACCGTCATCATTTATCTGCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009450

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009450 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75250.1 +3 2e-26 100 45/71 (63%) RAD-like 6 | chr1:28245073-28245453 REVERSE LENGTH=126

Transcript Sequence (618 bp)

>PGSC0003DMT400009450 618 pgsc_dm_v3.4
CATTTTTCTTTTATTACTACATACATTTTTTTTTCAATTTTTTTGCAAATATGGCCACAA
ATTCAACGTGGAGTCATCATCAAAACAAGTTATTTGAGAATGCATTGGCCATTTACGACA
TCGATACACCAGATCGATGGCGTAAATTGTCCAAGGCAGTTGGTGGAAAAACAGAAGAAG
AAGTGAAAAATCACTATGAAAAACTTGTTGAAGATATAAAGCGTATCGAGTCTGGAAATG
TTCCATTACCTAATTATAATAGTGGTCGTAATAATAAAGGCCACAATTTCATGGATGAAG
AACAAAGGCTGAAGTATTTGAAGCTCCAATGAAAGCAAGAAGAGACTATTTTATGGAACT
CATAATATGCAGTAAATTAATAAATAATAATAAGAGAAGGATATAATTGATTTTGCTTTT
TAAAAAAACTTTAGGTATTTAAATTTGGTTTTCATTGTATTAAATTTTCCTTTGAGCAAC
TATATATACATGTACGAAGTACGTTTCCAAATGTAACCTTTCTATACCGTCATCATTTAT
CTGCATATTTAAATTTCTCGGTGTTATAAAGAAATATTGTTAAAACATATAATGTAATGT
GTTAATGTTATACGTATG