Microarray Probes on PGSC0003DMT400009388

Probe IDChipProbe Sequence
CUST_4964_PI426222305 JHI_St_60k_v1 TAGCTGCAGGTGATGCGTGCAATAAATTAACTAGTTGATGTAACTTGTATGGTTGTTAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009388

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009388 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G38580.1 +2 1e-65 203 95/128 (74%) farnesylated protein 6 | chr4:18034596-18035693 FORWARD LENGTH=153

Transcript Sequence (682 bp)

>PGSC0003DMT400009388 682 pgsc_dm_v3.4
GTTGTATATGTCTTGCTTCTTTCTGATATTAAATGTGTAGACAGTTGAAATAAGAGTGAA
AATGGACTGCGAAGGGTGCGAAAGGAGGGTGAGGAAGTCGGTAGAAGGGATGCGAGGGGT
GACGAAAGTAGAAGTGGAGCCAAAGAAGCACAAGCTGACAGTTATTGGTTATGTTGATCC
AGATAAAGTATTGCGACGAGTAAGACATCGTACGGGAAAGAAGGCTGAATTTTGGCCATA
CGTTCCTTACGATCTGGTGGATCATCCTTACGTGCGGGGCGTGTATGATAAGAAGGCTCC
GGCAGGATACGTCCGCAACGTCTATGATAACCCGCAGGCTTCGAACCTGGCGAGGGCGAG
TTCTACTGAAGTCAACTATATTACTGCCTTTAGTGATGAAAATCCTCAAGCGTGCATGGT
TATGTGAGAGAGATCAATTGAGCAAAAGGAGGTAAAAAAACTAGTGATTATATACCTTCT
TACTGTAGTCTGTAGAGTAGGGACTTTTATGGATTTTAAGCCCCGTAGCTGCAGGTGATG
CGTGCAATAAATTAACTAGTTGATGTAACTTGTATGGTTGTTAATTAAGGTTTTTACTTA
TTTTGTAGTATGTTAAATATTATGACAGTTGTATATATCAGTCTGATTTCATGTGTATTG
ATATTAATAATTTCACTGTTTT