Microarray Probes on PGSC0003DMT400009311

Probe IDChipProbe Sequence
CUST_5182_PI426222305 JHI_St_60k_v1 TGGGCTTATACTGCTCTTGCTGGGGTTGAGAGGAATATTCAGAACAAACAGAAGGCAGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400009311

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400009311 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36250.1 +1 0.0 577 282/469 (60%) aldehyde dehydrogenase 3F1 | chr4:17151029-17153381 FORWARD LENGTH=484

Transcript Sequence (1392 bp)

>PGSC0003DMT400009311 1392 pgsc_dm_v3.4
ATGAATGGAGTTGAGGAGGATGTGTTAGGTGAACTGAGAACAACATTCAGGAGTGGAAGA
ACCAGAAGTGTTGCATGGAGGAAAGCACAGCTTCAAGCAATTCTCAAACTCCTTGATGAA
AATGAAGAGGAGATCTTTGAAGCACTTAAACAGGATCTCGGAAAGCACCCCGTTGAATCT
TATCGTGATGAAGTTGGTGTGGTGAGGAAATCAGCTACCAATGCTTTGCGCTGTGTTGAG
AAGTGGATGGCCCCTCAAAAGTCTGTTATTTCATCTGCAGCCCTAACTTTAGACCCAGCG
ATTGGAGCAATTTCAGCTGGTAACACAATTGTCCTCAAACCTTCAGAGCTAGCACCAAAA
TGCTCCTCCGTTCTGGCCAATACAATACCTCGTTACTTGGATCCAGAAGCTATTAAAGTT
GTTGAAGGTGGACAAGATGTATCAGAACAACTACTGCAGCTAAAATGGGATAAGATATTT
TTTACAGGTAGTCCACGAGTTGGCCGCCTCATAATGTCAGCAGCTGCGAAGCACTTAACA
CCTGTGACTCTAGAGCTTGGTGGAAAATGTCCTACCATCTTGGACACGCTATCTAGTTCC
TATGATTTACAGGTGGCTGTCAAGAGGATAGCGGGGGGCAAGTGGGGACCATGCAATGGA
CAAGCATGCATAGGAATCGATTATGTGCTCGTGGAAACACAATTTGCTCCGGTTCTGATT
GAACTATTGGAGAAAATCATCAAGACATTTTATGGTGAAAACTTGAAAACTTTGGGAAAT
CTTGCCAGAATAGTGAACAAGCACCACTTTGATAGAGTACACAATCTTCTGAAAGATCCA
AAAGTTGCAGCATCTGTTGTTTATGGAGGCTCAGTAGATGAGGAAAATATGGTCATTGAA
CCAACAATCTTGTTGAATCCTCCACTTGATGCTGATATCATGACCGAAGAAATATTTGGC
CCATTGCTTCCAATCATCACACTAAACAATATCGAAGAAAGCATTCAGTTCATAAACTCA
AGGCCAAAACCTCTTGCAATATATGCATTTACCAAGAATGATTCGTTGAAGGAGAAAATC
TTGCAGGAAACATCTTCCGGAAGTCTGACTTTTAATGATGCTATGATTCAGTTTATATGT
GATACATTACCATTTGGAGGCGTTGGTCAGAGTGGCTATGGACGTTACCATGGGAAGTTC
TCTTTTGACACATTCAGTCATGAAAAAGCAGTTCTACATAGGAGCTTATTAATTGAGTTG
GAATCAAGGTATCCTCCATGGAATAATTTCAAGTTGGAGTTTGTCAGATTGGCTTATGAC
TATGACTATCTTGGGCTTATACTGCTCTTGCTGGGGTTGAGAGGAATATTCAGAACAAAC
AGAAGGCAGTAG