Microarray Probes on PGSC0003DMT400008935

Probe IDChipProbe Sequence
CUST_18378_PI426222305 JHI_St_60k_v1 GTTGCCCTTTCTCTGTGAAAAGAAATCACTAATACTTTTTATGTGTCGATGTTGTGGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008935

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008935 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52820.1 +3 1e-43 159 86/226 (38%) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr1:19669216-19670321 FORWARD LENGTH=317

Transcript Sequence (1546 bp)

>PGSC0003DMT400008935 1546 pgsc_dm_v3.4
TTTATTTCTTTCTATTTCCTCTCTATTTAATTTATTCATCAATGGCATCTACCAAAGTTA
AGATTCCCACCATAGATTTTTGCAATCTTGAGCTAAAACCAAACACTCCACAATGGGAAT
CAACAAAAGTTCAAGTTTTTGAAGCCTTAAAAGAATTTGGTTGTTTTGAAGCAATATATG
ACAAAGTTCCAAATGAAATTAGAGAGGGCATGTTTGATACTTTAAAAGAAGTATTTGATT
TTCCAGTGTCCAAATTGATAGAATATAGAGAAAAACCCCATTTATATGATGGGCAAATTC
CAAGTATACCACTCTATGGTAGTGTGAGCTCTGCTGATTTGGTCCTCCCAAATAGTGTTG
AAACATTTGCCAATACCTTTTGGTCTGATGGAAACCCTAACTTTAGCAATGTGGCAAAGT
CCTACTTCAAGCAACTTATGGAATTGAATGACATGGTGGAAAAAATGGTTTTGGAGAGTC
TTGGGAAAACAAATTACATTGATGAAATCTTGAATTCCAATGTTTTTGTGTCAAGATTTA
CTAATTACAAGGTAATTAAAGGTGAAGATGAGAATAGATCAGAATTACCTCCCCACACAG
ATAGTGGCTACTTGACTATAATTAAACAAAATCAAAATGGATTGCAAGTTCTCTACAAAA
ATGGAGAGTGGATAGAGCTCAATAATACAACACCAAATTCCTATATTGTTTTATCAGCAG
ATGCTTTCAGGGTAAGTTATTATTTATTTTTGAGTATCAAGGTAAAAAATACACCTAAAT
TATTTATTTATGTGTATTTTTGACGCTTAACTCTTTATTATTTTGTGTGTGAGGGGGTGG
GTTGATGCTATAGAAGAGGAGAATAAAAGAAATAGAGATTTTTTTGTATGGTTGATTATT
CAAGCCCAACTAGAAGCTAAGATCAGAGCAGTTTTGAAGTAACGATAAGATTGTTTGTAT
GTGATTTATAGATTACGATGCGGGCTTGATCGAGAAAAAATCACTAATATTTTGTATTAG
ATTAGATTGTTTTCCTAACATCCCTTGAGGTGTTGCCCTTTCTCTGTGAAAAGAAATCAC
TAATACTTTTTATGTGTCGATGTTGTGGATTTATACAGGCATGGACAAATGATAGTTTGA
CATCTGCTGAACACAGAGTAGTAACAACAGGAGACAAAGATAGACTATCTATTCAATTAT
TTTCCTTTCCCAAATCAAGATTTTGCTGTGAAGGCCCCAAAATAATTAGTGGATGAAGAC
CACCCTTACTCTTCAAGCCTTTTAACTTGCTTGAATTTCATAAATAAACTATGTCAGGTA
ATAAAAATTGAATTAATCTCAAGAATTATTGTGGTCTTTAAAAATTTAGTAGGGTATTTA
TTTATGTGTATTTTCTTTATGAATACAATGTATCGTATGCATGGGTGGTTGAAAATTTAT
ATTTGTGTGGTTATTGCATATGATTTCATAACGTATTGTATTGTGTTGTGTTGCGTTGTA
TTGTAATGTATTGTACTGTATTGTTTTTATTAAAAATATATTAGTG