Microarray Probes on PGSC0003DMT400008751

Probe IDChipProbe Sequence
CUST_9693_PI426222305 JHI_St_60k_v1 CCGGTACATACACATCCATGGAGGAAATAATACACCTCATGTAATTATGTATTTTACTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008751

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008751 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G15240.1 +2 4e-158 459 234/420 (56%) Transmembrane amino acid transporter family protein | chr5:4947762-4950211 FORWARD LENGTH=423

Transcript Sequence (1434 bp)

>PGSC0003DMT400008751 1434 pgsc_dm_v3.4
CAACTCACAGGTACCATCTCCTTTTTTTTCTTCTTTGTTGAAAATGGAAACCAAAACAGA
AAATGACAACTCTCTTTCCTTACCCATGTTGGCTGATGACTGTGATAAAGCTGAGAAGGG
AATTGGATCAGATAGACTTATTAGCAATGGCAAAACATCCTTTCTGAAAACAACTTTTCA
TGGACTCAATGCTCTATCAGGAGTTGGGATTTTGTCGACTCCATACGCATTATCATCAGG
AGGGTGGTTAAGCATGATACTTCTTCTTCTAATTGCATGTGTAACTTTCTACACATCCTT
ATTAATAAAGAGATGTATGGATTTTGATCCAACTATTACAAGTTATCCCGACATTGGAGA
TCGTGCATTTGGAACAAGAGGAAGAATATTGGTTTCAGTTTTTATGAATCTAGAACTTTA
CATGGTTGCAACTGGTTTTCTAATTCTTTCAGGGGACAACTTGCATAATCTGTTACCAGA
TGTGAACTTTGAGTTTTGGGGACTCCAATTTGGTGGAAAACAAAGTTTTGTCTTGATTGT
TGCTCTCCTCATATTGCCAACCGTATTGTTAAAGAACATGAGCATTCTTGCGTATGTATC
AGCCTCTGCAGTATTAGCTACTCTCGTGATTATTGGTTTGATTTTCTGGGAAGCAACGTA
TGATGGCATTGGATTTCATAAAAGTGGAGTAGTTGTGAATTGGGGAGGAATCCCTACATC
GTTTAGCTTATATGCCTTCTGTTATTGTGCCCATCCTGTTTTTCCAACTCTCTACACTTC
AATGAAAAACCAAAACCAATTTTCTAAGGTAATGCTTGTGTGTTTTGTGTTCTCTACCGT
AACCTATGCATCAATAGCAATTATGGGATACTTAATGTTCGGCTCTGATCTGGAATCACA
AATCACATTGAACCTTCAACCGGAAAAATTTAGCTCAAAATTGGCTATATACACAGCTTT
GATCAATCCAATAGCCAAGTATGCATTAATGATGACACTAATTATTAACAGACTTGAGGA
GCGTTTGCAGTCATATTGTGACAAAAAATCATTTAGCTACCTGAACAGGACTATATTAAT
GATAAGCAGTGTCACTGTGGCTCTAACTATACCCTTTTTTGGGTATCTCATGTCACTAGT
TGGAGCATTTCTTAGTGTCACAACTTCAATTTTGGTACCATGTTTCTGCTACTTGAAGAT
TTTGGGCACTCATAAGAAACTTGGATATGAGCTAGTCATAATAGGATTTATAATTATAAT
GGGGATCATTGTCTTAGTTACCGGTACATACACATCCATGGAGGAAATAATACACCTCAT
GTAATTATGTATTTTACTGAAAAATATTTGTGTGTGTTCTATGGGTTTCAATAGTTGTTT
AACTTGTTATGAAAACAAATTGCTACTGTTACTAAATCAAAAATGATCTTAAGC