Microarray Probes on PGSC0003DMT400008569

Probe IDChipProbe Sequence
CUST_51147_PI426222305 JHI_St_60k_v1 GTCTTGTGATGAACTCGCAACAAGATCAGCCTCATGAAAATTAATCTATGAATTAGGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008569

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008569 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G67300.1 +1 6e-71 231 146/322 (45%) myb domain protein r1 | chr5:26854109-26855026 FORWARD LENGTH=305

Transcript Sequence (1459 bp)

>PGSC0003DMT400008569 1459 pgsc_dm_v3.4
GTAAAGGCGAGGCTCCGCCTCTCACCACCGTCAAATTTGTAAATATTATCTCCTCTCCGT
CGCCGGAAATTTCTCTGTTCCCGTTTTCTCTAAATCTAATCTTACTTTTTTCTTACGGTT
AATTAATCGGTTGCTATTCCTTTGATGGCGGCGATTACGCAGAGAAAAGATTCGGATCGG
ATCAAAGGTCCATGGAGTCCTGAAGAGGACGAGTTGTTGCAGACGCTTGTTGAGAAACAT
GGACCTAGAAACTGGACTTTGATAAGCAAATCGGTTCCGGGTCGATCTGGTAAATCCTGT
CGTCTCCGGTGGTGTAACCAGCTTTCCCCTCAAGTGGAGCATCGTGCTTTTACTCCTGAA
GAAGATGATACTATCATCAGGGCTCATGCGAAGTATGGTAACAAATGGGCGACTATTGCC
CGTTTGTTATCGGGTCGGACTGATAACGCTATTAAGAACCACTGGAACTCTACTCTTAAA
CGTAAGTGTCCTTCCATGTCCGAAGATTTAAGCTTTGAAACTCCTCAACCGCCTTTGAAA
AGATCGTCTAGTGTTGGTCCTTGTACCAATTTTTCTTCTGTTATGAATCCGGGTAGTCCG
TCTGGATCCGACTTGAGTGATTCCAGTCTTTCGGGTTTTCCCCAACCGCTTGTTTATAGA
CCTGTTCCCCGTACCGGCGGGATTTTCCCTCTTCCTCCTCCTCCTCCTCCGGTTAAGCAG
ATTGAAATTCCTTCATCTGTACCCGACCCACCCACATCTCTCTGTCTTTCCTTACCCGGA
TCCGGATCTATTGAAAAACCAACCCAGTCCCCTAATTCACCACCACTACCACCGCCTCCT
TTGCCGGTGGTTGATAAACCGATTCCCCCATCTGCAGCCGTCATGGGTCATCTTCCTCGA
TCCAATCAAAGTTATGATTTTTGTGCTGCTCCCAAATCAGGAGAGAAACAGTTTTTTACT
CCAGAGTTCTTATCAGTTCTGCAAGGTATGATTAGAAAGGAAGTGAAGAGTTACATGTCT
GGGTTTGAACAAAATGGTATCTGCATGCAGACCGATGCAATAAGGAATGCAGTCATTAAG
CGTATTGGCATCAGCAAGATTGAGTAATCCATCTATGATTACAGTTGAACTGTTCTATAG
TCATCAACTGTGGCTGCCGCTGCTCAGCGAAATGACACTGGAGAAGAAACAATGGAAGTT
CGGAGCAGTCTTCCTCCCCCACCCCTTTTTTTTATTGCTTAATTACTTCCGTAGAATTCC
AATCAAAAAAATAATTTTGCAGTAATGTACAGATGAATGAGAGGATGAGAGAAGAAAACT
AAATTTGAAAATGCCGAAAAGATGAAAATCTGAGAAAAATCTCTTTCTCTTGTCTAATGT
CTTGTGATGAACTCGCAACAAGATCAGCCTCATGAAAATTAATCTATGAATTAGGAAATT
TTAACATATACTTTTTTAA