Microarray Probes on PGSC0003DMT400008556

Probe IDChipProbe Sequence
CUST_51148_PI426222305 JHI_St_60k_v1 CTATCACAGTAAAACACTATTAGATCTGCTGATGTTGCAACTTGATTTTCGAAACTAAGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008556

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008556 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G37320.1 +1 3e-62 207 107/202 (53%) cytochrome P450, family 81, subfamily D, polypeptide 5 | chr4:17559742-17561690 REVERSE LENGTH=495

Transcript Sequence (894 bp)

>PGSC0003DMT400008556 894 pgsc_dm_v3.4
TTCATCTCTATTTACATGTTCTTTATAGCTTGTAAAGGTAGAAAGCTAGCTGATTGAATT
GTGCTACAGGTCATATTTATTGCTGGAACAGATACCTCGTCAACATCCCTCCAATGGGCG
ATGCGTCTTCTTTTAGCTCATCCTGAGGCATTGCATAAGCTGAGGGCTGAGATTGATAGC
CAAGTAGGGAACGAGCATTTGCTAAACGAATCTGATCTCACTAAACTTCCTTATTTGCAT
AGTGTTATCAATGAGACGCTAAGATTATACCCTCCAGTACCACTTCTATTGCCTCACTAC
TCATCAGAGGATTGTACTGTTGGTGGCTACAATGTACCAAAACATACGATCCTACTGGTT
AACATTTGGGCCATTCAAAGGGATCCCCAAGTATGGAAGGAGCCTAACGAGTTCAAACCA
GAGAGGTTTGAGGCAATGGAAGGGGAAAAAGAAGGATTCAACTATAAACTTATACCATTT
GGAATGGGGAGAAGATCATGTCCTGGAGCTACTATGGGCACGCGTGCTATTTCATTGGCG
CTTGGTGCACTTATTCAATGCTTTGATTGGCAAAGTGCGGGAGAGGAAAATTTGGAGTTA
AGCTACAATTCAAGAATCAACATTCAGAAAATTAAGTCCTTGGAGGCTATTTGCACTCCG
CGTTCCAACTTTGTGCAGCTTCTCTCCCAGCTTTGAAATAATGATGTATAAGATGAAATA
TAATACCTTTACAAGTGAAGTTTAATCATTATGTGTAGCTAATGGTTAGAAGTGAATAAC
ATCTTCTTCATCTATCACAGTAAAACACTATTAGATCTGCTGATGTTGCAACTTGATTTT
CGAAACTAAGCTTTATAATACAAATGATTATACAGGTAATAGTTTCAGCTTTAA