Microarray Probes on PGSC0003DMT400008502

Probe IDChipProbe Sequence
CUST_17345_PI426222305 JHI_St_60k_v1 CTCCTCAGGATACTTCAAGTTCAAGTTCTAACATCTCTTAGGACAAATCATTTTGTTTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008502

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008502 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G07020.1 +1 2e-53 179 120/147 (82%) proline-rich family protein | chr5:2180669-2182284 REVERSE LENGTH=235

Transcript Sequence (1048 bp)

>PGSC0003DMT400008502 1048 pgsc_dm_v3.4
ATAACCCACTCAACGTGCATTCAAATCAAACCACAAAAACTAAACCATAAGAGGATTTTG
GAGGCTCAAACACAGCCAATCGAAGAAGCAAGAGATTTCTACAAGTGGTTCTGCTTCTTC
ATCACTTCAATATACCTAAGAGACACCACCATTTTTGGGCTACAAACGAATTTGCAGATA
ATGGCTTGTGCTGCTTTATCAGCAAACAGCTGCACCATAGCTTCATCTTCCAGTGGAAGA
TTGAGCTTTTCCACATACCAAAAGGACTCAAAATTGAGGCAAAGACAGAGTCTCGTTCGA
TTCAGAATTCGGGCTTCAACTGATGATTCTGATTGCAATGCTGAAGAATGTGCCCCAGAG
AAGGAGGTTGGGAAGGTGAGCATGGAATGGGTAGCCATGGACAACACCAAAGTGGTTGGG
ACATTTCCACCCCGTAAGCCGCGTGGCTGGACAGGGTATGTTGAGAAGGATACTGCTGGG
CAGACAAATATATACTCTGTTGAGCCCGCAGTTTATGTAGCAGAAAGTGCTATCAGCTCT
GGGACTGCAGGCACCTCATCTGATGGAGCAGAGAACACCGCAGCTATTTCAGCTGGGATA
GCCTTGATCTCTGTTGCAGCTGCTTCATCAGTTCTCCTTCAAGTTGGGAGGAACTCACCT
CCTCTGGTACAAACAGTGGAGTACTCGGGACCATCCCTTAGCTACTATATCAACAAGCTT
AAGCCAGCGGAAATAGTCCAAGCTTCAATAACCGAAGCACCAACTGCACCAGAAACCGAA
GAAGTAGCAAATGCACCAGAAGTTGAAAGCTCTGCTCCTGAAGCTCCTGCTCCACAAGTT
GAAGTCCAATCTGAAGCTCCTCAGGATACTTCAAGTTCAAGTTCTAACATCTCTTAGGAC
AAATCATTTTGTTTACTTGTATATTTTTATTTGTAGATGACCTAGTATACATATTTCAGT
AAGTTTTTGTAATACTACTATTCAAAGAGAACTATTCTGCGTGTCGAAAATCAATTATGA
ATCCTTAATTGAGTTAGCTCAATGATCA