Microarray Probes on PGSC0003DMT400008451

Probe IDChipProbe Sequence
CUST_41174_PI426222305 JHI_St_60k_v1 ATTCAAAGCTAATGAACTTTGATTCTCCTTGCAGGTTAGTGTAGATTATTTAACGAAGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008451

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008451 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G29590.1 +2 2e-48 176 80/91 (88%) S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | chr4:14512736-14514404 REVERSE LENGTH=317

Transcript Sequence (2737 bp)

>PGSC0003DMT400008451 2737 pgsc_dm_v3.4
CCGTCATTTTGATTAACCGTAGAATTTGTAGAAAGGGTTTTAAGGCAAGTCAAATAAGGT
CGTCAAATTCATTTACTTTAGACTGAAAGTTCAAGGTGATGGATTAATACAAGAATGTAA
TATGCTACAAGGAAAAAGGGAATTCAATTGAGGGGAAGATTTAGAGCCTTTCCCCAAGGA
AATTCTAAGGGAAGAATGTAAAAAAGACTAGTGTATCACTCTCCTAGATTTTTCGATGCC
TTCTATTCTTGTAAGAGTCCTCTTTTATAGGCCATAAGAGTCGAACCATCGCGTCAATAT
GAAACAGAATGCATGCTTAGCACTGAAAAGGCTACCTAGTAGCACGTGCCTACTCTCTGA
CGCTTTGCCTGGAATGATTGGGGGCAGGTTGGCCCACAACTTGAGATTGATTGTTAATTC
CACCCGAGAATCATTATAAGGGTGTCCAACTGAAGATGGCCTTCCCCGGGGAAAGGTCTT
GTAAGATTTCCGGTCACATGGCAACTTTATATGATCATATGTCAACACCCCGGGTCGCAC
CGGGAACAGTCCCTCCCAATTTCCCCGGGTTATAACAAGCATTTCTTGGTCTTGATTTTA
CCACGTGTCACAGTCTAGTTCGTCAGACGTATTTTTTTCCCCATACAGATAGTTCCCCAC
TTTACAGACACCTAATGAAATGTATCCGGGAAGTGGAATTTGCTGTGCTGTTTTCGGGGC
TGACGATGATTGATTGCTACTGCATATAATGGGGCTTTTGGTTCGTTGCACTTAGACCGT
CCTGTCACGTACCTCTTTTCACTTGGATCATCGTAGACATTGGATTTTAAAGCCATCACG
AATACCTTTTGACAAAGAATCCTGTGTTTGGTTCCTTGTTAAAAAGCTTACGAAATAAAA
CTCCTCCAGGACAAAAGACCTTACCAAGGCAAAGAGTGTAACATATGCCTTTTGGCTTCC
TCAAGAATTTGGCTACTACAGAATCGAGGATCAGCAGCCTGTCATCGTAAGCTATCTTCC
TTAAGTCTTTTAATCTGACGTGCTTTCGGTCATCCCTTATCCTTCGGTGTCCTTGCCCTT
TCCTATATTAACAACTTCTTAAAAATGGTTAGCCCAAATTAAAAGGGATTTTATTTGATC
ATGCGGGAGCATGTGATCCTGTCTAGCCATTGAATGGAGGTGAGCCTCTTCACTGCTCAT
AAAGTAATATTTGTTTCCTAATAACTGATGGGATTTCCCCGTGGACACTTAGTCAGCCTT
TCAAAGTTTTGGTTGTTGATCTGGTGACCCCCCCTGCCCAGAGTTGTCCCAGATGCGTTT
GAATTTGCGTCTGTCTTAGCAATCGGGGAAAAAACCCTCAATTTGTTTGAGAGTGTTTGG
GCATTAGTGTCAGACTTTTTTTCTAAAGGAGAATACTTTACCGTAAGGGTCAACCGTCTC
AAACCTATTCAAATCTATATTCATTTTAGAGTAATGGGGGATGATCATCTGAATAGCATG
AGAGAACACTTAACCATAAAGATCAGCCGCTTCCATCCTTGTTCGGAATTATGTTTTGTA
TTAACTTGTTGGCAAGAGTACTCCTGGATTAGAAGGATGATCCCTTGGCAGGTCGCAAAA
GACCCATTTCATTCCATGGCCTTCTTCCTTGGGGTCGAGTTCTTGACTAAATCTGAGTAT
GTGACATCAACCACGAATTATTCTTGGGAAATGACCATTCGGTACATAAAGAAGAAAGAT
AGGGGAGGGACCCCGTTTCTTCATAAAGAAGAGACCTTTATTTTGTTTAGGTGCTCTCGA
GCAGGAAGTCTTGACTCCATTTTTAGGCACAAGGTTTCTTGGAACCTTCTTACGGTATGA
GTCCAGAGGCTGCATCATTTAGCGGGAGGTTTTACGATTTTGAGTATGTAGTTTGTATCA
TTTGGCGATTTGAGTCCAGAGACAACATCATGGGTGGGAGCTTTTACAATCTGAGTTCAG
AGATTTTATTTGTTGGCGATTTGAATCTGGAGAATGCACCTTGCAAGTTAGACAACTATC
CTACCCTGATGTTGAGAGCCTGTGATAAGTTATAGACAACACTTGGGATGATTCAACATC
ACATCATGTACTTCAAATCTTAAGTTTGCATCATTGTCATAAATGTATCATTGTTCTAGC
AAAAACAAAATTCAAAGCTAATGAACTTTGATTCTCCTTGCAGGTTAGTGTAGATTATTT
AACGAAGCCTCTTGATGTTTTCAAAGAAATGTCGCGTGTTCTTAAACCTGGTGGACTTGC
AATTATGAGTTTCTCGAATCGCTGCTTTTGGACAAAGGCTATCTCGATATGGACATCAAC
TGGAGATGCTGATCATGTTATGATTGTTGGGTCCTATTTCCATTATGCTGGTGGATTTGA
ACCTCCACAGGCTGTGGATATATCTCCTAACCCTGGCCGCTCAGACCCCTTGTATATAGT
CTATTCCAGGAAGATAGCGACAGCCTGAAATTCAACGCTCGTCCAGCTATAGAGTTTTCT
TGTGCCATTGATCACATCATAATGTATAGTGAGGAGTAAGTGAAAGGTGATTGATAACAT
TTTCCTTCATAAAATGTGATCACGATCCCGTTTTAACTATCATAACTTGATGGAGTTGTG
TATATTTTTAAGTTGAGGATAAATTTTGAGGAAAGAAACAAGTCCAACATCACAGATCAC
AAACACCTAATTCAAGACGCCATCTAGTCTTAACAAT