Microarray Probes on PGSC0003DMT400008367

Probe IDChipProbe Sequence
CUST_17421_PI426222305 JHI_St_60k_v1 CTCTTTCCCCTGTTACAGAGATTGTTTCCATACTGTAATGAGAAATATTGCTGGTTTATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008367

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008367 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G57680.1 +1 9e-24 102 91/300 (30%) FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031277 (InterPro:IPR016971); Has 70 Blast hits to 70 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | chr1:21362749-21363837 REVERSE LENGTH=362

Transcript Sequence (1626 bp)

>PGSC0003DMT400008367 1626 pgsc_dm_v3.4
GAAATTTCTCAAAATCCACTAACCAAAAATATCTGACTCTTCTTCTCTCTCCTTCAAACT
CAAATCCTCTGCAAATTTGCCTGTTTTCCCCCAAAACTCTACCCGCCATTTCCGACCTCC
CAAAACAATTATGCAATTCCAACAACTAATCACAAAAAATAAATCACCGTTCTATCACCA
CCGTCACCGGCACGGTGGCCGGCGAATCATTCACCACCAACCACCACCACAACTTTCTCT
ATGAGAAAATCACCTTTCTATGTTGCTAATGGCTCCGAAGCATCTCTTTCATCTTTTCCG
TTAATACCAGGTTCTACGATATTATCTACGCCTTCACATACCCCTTCCGATTTCAATTCC
AGTTTGCCGTTGCCGGATCCATACTCAAATTCTACTTTCCTTTTTCCTTCTGCTCCTGTT
GTTGACGGAACCTTTGATTTCGTAACAATTTGTTTTATTTCCGGTCTTCTTCTTCTTTCT
CTACTTTCGTTTGTGTTTATCTTCCATCTCCGTCTCAGATCTCGTCAATATCCGCATCTT
AAAAATTTCAATTCTCTGTGGACCGTCCGTTTACTCCTTGTTTCCTTCGCTATTCTTTGG
GCGTTAAACGAAGTTTTCCGGCTGCATTTCATTCGCCGGAATTACATTCTCCCTTTCTTT
CCACCTCTAACCCTAAATCAACAAGCAAATCTGTGTAAAGTTCATGTGGTTCTCTCCGTA
GGCTTATTTGAACCGGCGTTCTTAACCACCCTTCTTTTCTTAGTAAACGTGTCCATTAAG
AAACATAGTCCAAGTGGAATTTGGGCTGTCATCGTCGTCTGGCCGATTTGTTTACCTCTT
TTGTTGCTTCAGATCCTTGCTGTGTTCTTCTCCCCATTGCAGAAGCATCTACCGATATAC
CTGCATTCTAGCTCCTTCGTTTCAACAGATATCTTGGGGAACCAGACGGTTCTCTGTACT
TACCCTGTGTATAGTTCTATTTTGTTTGGGGGATTTACTGTTGCTTACTTGTTAGCCTTT
GTAATTTCGTGTTGGAGAGTTATCTCCTTTGTAATTAACAGAAAAATTCAGGTACGGGTG
AATTTGCTGGCGACTTCTTTCATGATTGCGTTGCCTTTGCAGATTCTGTGCTTAGTATCA
TTACCAATTCGGCCGCCGGATGATCCATTCCACGGTGTTTCCATGATGGTGATGTTCTTG
GCTGTTGCGTGGTGTATAACGGTTGGGGAGGTTACTTTGGTAATTAAGCCGATTGCAGAT
GCATTTCTCGCTGGTAGAGCAAGTAGCTGCCGTTTGAATCCCGGAACTACGTTAGGACAT
CCGAACGGTGATGGAGGAAGAGTGGAAGGACGGAGTTAGTAGCAATGAGAAGTGGCCATG
ATCGCCGACGGAGGACATCATGGTCATTTTACTAATCAACAGAGGGCGCTATAGTTATTA
GAGTTAGTATAGTTTAATATGCCCTCTTTATGTAATTCTTAGAAATTAGTGTACCATATA
TGTAATTAGCAGCTTATGAAATAGCCAACTCTTCTCTTTCCCCTGTTACAGAGATTGTTT
CCATACTGTAATGAGAAATATTGCTGGTTTATATTGTTACAGATGAGCAACGATTTCATA
TTGTCG