Microarray Probes on PGSC0003DMT400008346

Probe IDChipProbe Sequence
CUST_17516_PI426222305 JHI_St_60k_v1 AACTCCTTGTTCATATAGGCTTGTTGATACACACATAGAATATCTTGATGTCATCATCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008346

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008346 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G54165.1 +1 6e-10 54 39/95 (41%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:21984620-21984868 FORWARD LENGTH=82

Transcript Sequence (637 bp)

>PGSC0003DMT400008346 637 pgsc_dm_v3.4
CTTCTTTTCTTCGTACTCAAGTTTTAATTTAACATAAACTCACTGCTTACATCAACAAAT
CAATACTCTCTTTATTTTCTTGTTATTTGTTAGTAATTTGCAAGTGAATCGCCAACGATG
ATGATGTCAATTTTCAGTTCCTTTGATGCCCTCTCTGCTGAACTTTTTGGGCAGAAATTG
AGTTTTTCTAAGCCATCTAGTACTGACACAAAACAACAAGGGGTTGGAACTCTTGTATCA
GATCAAAAAACCGCCGCTTCTCCGCCGGCTACTTCTTCAACCGGTATTCTGAAGAAGACC
GGAGAGGCATCGCCGCCCCAGCAGCAGCAGAAGAGGCAGAGGTTCGCGCTGGAATTCGAC
GGCGTCCACTGTTTTGAAACTATAATTCCCTATTGATTTTTGTTTTTACTAAAATTACGA
GATTGAAATTTCATTTATTCTTGTCTACCATGATCATTGTCATGACTCATGTATGATGTA
AATTTTGGTGATTGATATATACGTACAATTTATGGATTTTGATATCAGTTTGTAATTTCT
CTTTTTTCTTTCATAGCTCTGTTTTACGTCAGAGTAAAACTCCTTGTTCATATAGGCTTG
TTGATACACACATAGAATATCTTGATGTCATCATCTG