Microarray Probes on PGSC0003DMT400008200

Probe IDChipProbe Sequence
CUST_17452_PI426222305 JHI_St_60k_v1 TGTTTTTGTTCTATTCCGAGACTTGTATTCAATGCAGCAGTTGTTTAAAGCACCTTCTCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008200

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008200 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G16820.1 +2 6e-94 305 203/436 (47%) heat shock factor 3 | chr5:5530446-5532497 FORWARD LENGTH=481

Transcript Sequence (2427 bp)

>PGSC0003DMT400008200 2427 pgsc_dm_v3.4
TACCAAAGGTAGTTTTATGTAATAGGTAGGTAGAATTGTTTTAGATCAAATCACAGATTA
TTCTATGCTTTTGAGCCAAGGCATTTTGTCACAAAATTTAGTACTGCTTTATTTATGTAC
ATACCGAATCGCCAACATAGTTGATGGAATGTGATCCTGCAGTTAAGATGCTCAGGAGTT
CCTTAGACCGTTGCTAGGAGATATTGCATAACATGGGTCTTTAGAGTCCAATTGAGTGGA
CTTCACTACTTTCCAGCTAGAGGTCAGGCTAGACAGTGGTGGAGAGCTTATGCAGAAGCA
AGCCAGCAGGTTCACTTCCTCCCAATTGAGCACAATTTGGCATCTCTTCCCACGTTTATA
TTTATCCACCAAACAACCAGGCAAAGTTATTTATTTTCATATGCCTATTAACCATCCAGT
TTAAATTTTTGTAAGTAATAGAGCTTGTCAAATTCTTTTTGAGTAATAGATGGATTTCAG
GGATTTGTTTGTGACCGGGGAGTTATGTTTCTTCAGAGTGTAGTTCTGCCATTGTGGTGT
ATTCTGCCTTTCTTTAATATGATATGGAGTCTCTTTGTACCCGCGGGGAAACTGTAATTC
TTTTTATAGTTTGCTTTTCCCCTTCATCAATCAGGGTTTCAGGAAGGTTGATCCAGACCG
CTGGGAATTTGCAAACGAGGGATTTCTTAGAGGCTACAAACACCTATTGAAGAGTATAAG
CAGGCGAAAACCCCCTCAGGTGCAGGGCCATCAACAAACCACCTCCAAAGTACCAAATGC
ATCTGTTGCATCCTGTGTGGAAGTTGGGAAGTTTGGAATAGAGGAAGAGGTGGAAAGGCT
TAAAAGAGATAAGGATGTCCTTATGCAGGAGCTGGTTAAGTTGAGACAGCAGCAGCAGGA
GACGGATCACCAATTGGTGACTGTTGGGCAGCGCGTTCAATTAATGGAGAACAGGCAACA
ACAAATGATGTCGTTCCTTGCCAAGGCCATGCAGAGCCCTGGCTTTGTAGCCCAATTAGT
ACATCAACAGAATGGCAATAACAGGCATATTACTGGGCTTAATAAGAAAAGGAGACTTCC
TGAACAGTCTGAAGAAAATGTTGCGTGCAATCCTGTCAATGCTTTGCAAGATGGACAGGT
AGTCAGGTATCAACCTTCAATGACCGAGGCTGCAAAAGTGTTGCAGCAGCAGATTCTGAA
AATAAATGCATCTGGGAGGCTGGACAACCGATTAAACACAAATGACTGTTTGACTAATAA
TCCCCTCCCGCCTCAAAATTCTCTAGACAGTAGCGGTGCATCCAGTTGTATTTCCAGTGT
TACCCTCTCAGAAGTAATGTCAACTTCTTCACAGCCTAATCTAATGTCAGATTCAGGATT
TCCATTCAACTCTTGTTCATCCATCATATCTGAGACCCAATCATCCACTACTGTGGTTCC
TGGGGAGGCCAACATTCCCGTATTACCTGAAGCTGATGCATTGAACTCTCAGGCAGTCCA
TGATTTGCCTGAATTTTCTCATATTCTTGGAGTAACTGACCTTGACCTTAATATGTCTGA
GACTGGAAATGTGCCAGATATTGACACAGCGCAAGGTATTTTGGATGGTTTAACAACAAT
TGTCTCTGATGAATTTTCAGCAAACACAGATGGTGATGTTTTGCTGGATGACATGCCTAA
GCTTCCAGCGATTAATGATATTTTCTGGGACCAGATTCTCTCTGCAACCCCTGCAAGCCC
TCTCACTGGGGATACGGATGAGATTGGTTCCCTAGTCGTGGAAGAGGATTTCCTAGGAGT
TCAGGAGAGTGATTGGGATAAACTAAAGCATATGCATCATCTTACTGAACAGATGGGGCT
ACTTTCATCAGTTGCCCAGATTTGATGATTTCATGTTTTTTTTAAACGCTTGCAATGATG
CAGGGTGTTCTGCGTTAGTGATACCACCTTGAGCACAACTGCTGAAGTGTGGTGAACTTC
TAGAGGGTGTAAAGCAATGAACTTCTCCCCATGTGGTAATATTTTTTTGTCAGGTGGATG
CTCTGAACTGGTGCGCATTAACAATCTTGTCTTGAAAGACTTTCTTCACTACTAATAATG
ATGTTCTGTGTAGTTAAAAAGGGGATCCCCAAAAGACTAGTTTGGTGTATTTTATTCCGG
CTTTTTGTATGTACATTTATCTGGCACAATGGGTTAGTTAAAAAAGAACACTAAAATGTT
CTTTACTTATTAAGAAATTGAAATAGGGATGCAAAGAAGTTGCTGCAGAGGATCTGTATG
TACCTTTTATTGTTTACATAATGATGATTTCAACGAAGATGCAAGCAGGATGAATGAACG
TCTTGTTTTTTGTCCAAATGTATTGTATGTTTTTGTTCTATTCCGAGACTTGTATTCAAT
GCAGCAGTTGTTTAAAGCACCTTCTCC